Incidental Mutation 'R7028:Pla2r1'
ID546100
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7028 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60458393 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 632 (K632E)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably damaging
Transcript: ENSMUST00000112525
AA Change: K632E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: K632E

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATATGCTGTGTACCAGGCCC -3'
(R):5'- TGTGCCAATGAAGCATCTTTC -3'

Sequencing Primer
(F):5'- GCCCTGTGACAGAAAGCTTAG -3'
(R):5'- GTGCCAATGAAGCATCTTTCTTCATC -3'
Posted On2019-05-13