Incidental Mutation 'R7030:Exoc6b'
ID546237
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84848825 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 535 (R535G)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
Predicted Effect probably damaging
Transcript: ENSMUST00000160197
AA Change: R535G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: R535G

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCAAGGAAGACTAACATGGGCC -3'
(R):5'- GGAATACGTCTTGTCATGTAGTACG -3'

Sequencing Primer
(F):5'- TAACATGGGCCAAGGAACAC -3'
(R):5'- AGTACGTATTAGGTACTGCTCCTTTC -3'
Posted On2019-05-13