Incidental Mutation 'R0610:Csmd1'
ID54624
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene NameCUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 038799-MU
Accession Numbers

Genbank: NM_053171.2

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0610 (G1)
Quality Score169
Status Validated
Chromosome8
Chromosomal Location15892537-17535586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15918208 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 3140 (R3140C)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082104
AA Change: R3140C

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: R3140C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125551
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Greb1 A C 12: 16,696,442 S1276A probably benign Het
Hhipl1 T A 12: 108,319,402 C490* probably null Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lca5 A T 9: 83,399,739 C331S probably benign Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Mapk9 A C 11: 49,863,573 N51T probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Zyg11a A G 4: 108,204,857 L249P probably damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17027323 missense probably damaging 0.97
R0505:Csmd1 UTSW 8 15992758 missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0511:Csmd1 UTSW 8 15932529 missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15906116 missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 intron probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4633:Csmd1 UTSW 8 16002620 missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAGAGTTTCCACAATGCGACC -3'
(R):5'- AGCTGCGATAAGAGCCACAGTCATC -3'

Sequencing Primer
(F):5'- CACAGTCACACATCATTATGCTGC -3'
(R):5'- CACAGTCATCAATGTGGTGGAAG -3'
Posted On2013-07-11