Incidental Mutation 'R7030:Pcf11'
ID546243
Institutional Source Beutler Lab
Gene Symbol Pcf11
Ensembl Gene ENSMUSG00000041328
Gene NamePCF11 cleavage and polyadenylation factor subunit
Synonyms2500001H09Rik, 5730417B17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_029078; MGI: 1919579

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location92643543-92669934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92657678 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1094 (D1094G)
Ref Sequence ENSEMBL: ENSMUSP00000113717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119954]
Predicted Effect probably benign
Transcript: ENSMUST00000119954
AA Change: D1094G

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113717
Gene: ENSMUSG00000041328
AA Change: D1094G

DomainStartEndE-ValueType
RPR 17 139 6.74e-43 SMART
low complexity region 173 194 N/A INTRINSIC
coiled coil region 202 243 N/A INTRINSIC
low complexity region 355 380 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
low complexity region 471 513 N/A INTRINSIC
low complexity region 793 819 N/A INTRINSIC
low complexity region 833 853 N/A INTRINSIC
internal_repeat_1 854 931 1.77e-14 PROSPERO
low complexity region 932 948 N/A INTRINSIC
internal_repeat_1 969 1105 1.77e-14 PROSPERO
low complexity region 1159 1178 N/A INTRINSIC
low complexity region 1294 1315 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115278
Gene: ENSMUSG00000041328
AA Change: D1016G

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 147 172 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 263 305 N/A INTRINSIC
low complexity region 716 742 N/A INTRINSIC
low complexity region 756 776 N/A INTRINSIC
internal_repeat_1 777 854 3.34e-13 PROSPERO
low complexity region 855 871 N/A INTRINSIC
internal_repeat_1 892 1028 3.34e-13 PROSPERO
low complexity region 1082 1101 N/A INTRINSIC
low complexity region 1217 1238 N/A INTRINSIC
low complexity region 1368 1381 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to CLP1 to form pre-mRNA cleavage factor IIm. The encoded protein is necessary for efficient Pol II transcription termination and may be involved in degradation of the 3' product of polyA site cleavage. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Pcf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Pcf11 APN 7 92661686 missense possibly damaging 0.51
IGL02439:Pcf11 APN 7 92661841 missense possibly damaging 0.93
IGL02658:Pcf11 APN 7 92647046 missense probably damaging 1.00
IGL02702:Pcf11 APN 7 92661618 missense possibly damaging 0.76
3-1:Pcf11 UTSW 7 92658518 missense probably damaging 1.00
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0078:Pcf11 UTSW 7 92669559 missense possibly damaging 0.90
R0110:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R0373:Pcf11 UTSW 7 92661215 missense probably benign
R0450:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R1717:Pcf11 UTSW 7 92663585 missense probably benign 0.00
R1952:Pcf11 UTSW 7 92661338 missense probably damaging 1.00
R1965:Pcf11 UTSW 7 92661601 missense probably benign
R2045:Pcf11 UTSW 7 92661879 missense probably damaging 1.00
R2245:Pcf11 UTSW 7 92665872 unclassified probably benign
R3824:Pcf11 UTSW 7 92659620 intron probably benign
R4439:Pcf11 UTSW 7 92658017 missense probably damaging 0.99
R4517:Pcf11 UTSW 7 92646488 missense probably damaging 1.00
R4671:Pcf11 UTSW 7 92657529 missense possibly damaging 0.62
R4674:Pcf11 UTSW 7 92659777 intron probably benign
R4675:Pcf11 UTSW 7 92659777 intron probably benign
R4732:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4733:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4758:Pcf11 UTSW 7 92661175 missense probably damaging 0.97
R4985:Pcf11 UTSW 7 92661902 missense probably benign 0.01
R5041:Pcf11 UTSW 7 92658405 missense probably benign 0.00
R5248:Pcf11 UTSW 7 92661491 missense probably damaging 1.00
R5688:Pcf11 UTSW 7 92658808 missense possibly damaging 0.92
R5814:Pcf11 UTSW 7 92657714 missense probably benign 0.00
R6240:Pcf11 UTSW 7 92646502 missense probably damaging 1.00
R6327:Pcf11 UTSW 7 92659609 intron probably benign
R6615:Pcf11 UTSW 7 92657882 missense probably damaging 0.96
R6795:Pcf11 UTSW 7 92657578 missense probably benign 0.04
R6896:Pcf11 UTSW 7 92649551 missense probably damaging 0.99
R6902:Pcf11 UTSW 7 92658299 missense probably damaging 0.99
R7135:Pcf11 UTSW 7 92657316 missense probably benign 0.05
R7162:Pcf11 UTSW 7 92664013 missense probably damaging 0.97
R7210:Pcf11 UTSW 7 92663476 missense probably benign
R7243:Pcf11 UTSW 7 92660060 missense probably damaging 1.00
R7362:Pcf11 UTSW 7 92653245 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCGTGTCTTTGGAACTGTAATCC -3'
(R):5'- AGAATTGAAGGGCCTCTGGG -3'

Sequencing Primer
(F):5'- TGGAACTGTAATCCTTGAGATGGAAC -3'
(R):5'- TCCTAGATTTGAAGGTTGTCACTC -3'
Posted On2019-05-13