Incidental Mutation 'R7030:Plxnb1'
ID546251
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7030 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109112307 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1677 (I1677N)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: I1677N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: I1677N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCTGCGCAGGTAAGTG -3'
(R):5'- ATATACAGAGGCTCTCCCACAG -3'

Sequencing Primer
(F):5'- GCAGGTAAGTGGCTGGC -3'
(R):5'- TCCCACAGAGTCCTGGGAAAG -3'
Posted On2019-05-13