Incidental Mutation 'R7030:Camk2b'
ID546254
Institutional Source Beutler Lab
Gene Symbol Camk2b
Ensembl Gene ENSMUSG00000057897
Gene Namecalcium/calmodulin-dependent protein kinase II, beta
SynonymsCaMK II
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5969644-6066362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5989575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 232 (D232G)
Ref Sequence ENSEMBL: ENSMUSP00000091046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002817] [ENSMUST00000019133] [ENSMUST00000066431] [ENSMUST00000090443] [ENSMUST00000093355] [ENSMUST00000101585] [ENSMUST00000101586] [ENSMUST00000109812] [ENSMUST00000109813] [ENSMUST00000109815]
Predicted Effect probably damaging
Transcript: ENSMUST00000002817
AA Change: D232G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002817
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 371 498 5.3e-63 PFAM
Pfam:DUF4440 375 489 2.8e-15 PFAM
Pfam:SnoaL_3 375 500 2.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000019133
AA Change: D232G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019133
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 511 533 N/A INTRINSIC
Pfam:CaMKII_AD 534 661 3.7e-62 PFAM
Pfam:DUF4440 538 652 1.6e-13 PFAM
Pfam:SnoaL_3 538 663 4.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066431
AA Change: D232G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065101
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 347 474 4.8e-63 PFAM
Pfam:DUF4440 351 465 2.6e-15 PFAM
Pfam:SnoaL_3 351 476 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090443
AA Change: D232G

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087925
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 390 412 N/A INTRINSIC
Pfam:CaMKII_AD 413 540 6.1e-63 PFAM
Pfam:DUF4440 417 531 3.2e-15 PFAM
Pfam:SnoaL_3 417 542 2.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093355
AA Change: D232G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091046
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
internal_repeat_1 373 388 8.07e-7 PROSPERO
low complexity region 391 414 N/A INTRINSIC
internal_repeat_1 416 431 8.07e-7 PROSPERO
low complexity region 434 456 N/A INTRINSIC
Pfam:CaMKII_AD 457 584 5.8e-63 PFAM
Pfam:DUF4440 461 575 6.7e-15 PFAM
Pfam:SnoaL_3 461 586 4.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101585
AA Change: D232G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099119
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101586
AA Change: D232G

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099120
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109812
AA Change: D243G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105437
Gene: ENSMUSG00000057897
AA Change: D243G

DomainStartEndE-ValueType
S_TKc 14 283 5.98e-95 SMART
Pfam:CaMKII_AD 397 524 5.8e-63 PFAM
Pfam:DUF4440 401 515 3.1e-15 PFAM
Pfam:SnoaL_3 401 526 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109813
AA Change: D232G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105438
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109815
AA Change: D232G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105440
Gene: ENSMUSG00000057897
AA Change: D232G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reversal of plasticity direction at parallel fiber-Purkinje cell synapses. Mice homozygous for a different null allele show motor impairments, including ataxia, altered body mass composition, a reduction in anxiety-related behavior, and cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Camk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Camk2b APN 11 5972310 missense probably damaging 1.00
IGL01821:Camk2b APN 11 5997890 missense possibly damaging 0.92
IGL02219:Camk2b APN 11 5976872 missense possibly damaging 0.56
IGL02890:Camk2b APN 11 6001340 missense possibly damaging 0.90
R1645:Camk2b UTSW 11 5972719 missense probably damaging 1.00
R1786:Camk2b UTSW 11 5977880 missense probably benign 0.06
R1836:Camk2b UTSW 11 5972384 missense probably damaging 1.00
R2133:Camk2b UTSW 11 5977880 missense probably benign 0.06
R3828:Camk2b UTSW 11 6028932 missense probably damaging 0.99
R4283:Camk2b UTSW 11 5987099 missense probably benign 0.39
R5919:Camk2b UTSW 11 5979718 missense probably damaging 1.00
R6074:Camk2b UTSW 11 5989635 missense probably damaging 1.00
R6269:Camk2b UTSW 11 5978497 missense probably damaging 1.00
R6595:Camk2b UTSW 11 5992856 missense probably damaging 1.00
R6999:Camk2b UTSW 11 5972321 missense probably damaging 1.00
R7396:Camk2b UTSW 11 5978432 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTGATGGTCAGCATC -3'
(R):5'- TCCCTAGTGACATAGGGTGGAG -3'

Sequencing Primer
(F):5'- TGATGGTCAGCATCTGGTTG -3'
(R):5'- ATCAGAGGCCGTTTGTGCC -3'
Posted On2019-05-13