Incidental Mutation 'R7030:Agtpbp1'
ID546266
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59504294 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 401 (T401I)
Ref Sequence ENSEMBL: ENSMUSP00000130939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165370] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000171606]
Predicted Effect probably damaging
Transcript: ENSMUST00000022040
AA Change: T401I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: T401I

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109830
AA Change: T401I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: T401I

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: T288I

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164215
AA Change: T401I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: T401I

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165370
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably damaging
Transcript: ENSMUST00000170555
AA Change: T401I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: T401I

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171606
AA Change: T401I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: T401I

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGGCCATTTCCTCAGACATG -3'
(R):5'- TGCTGAGATTAACCCTCACCAG -3'

Sequencing Primer
(F):5'- TCAGACATGAGAGGTGGCAGTTATG -3'
(R):5'- AGACAACAGAGTCAATACCAGTG -3'
Posted On2019-05-13