Incidental Mutation 'R7030:Fer1l6'
ID546275
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58629378 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1302 (F1302I)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: F1302I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: F1302I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGATCTGATACTTAAAGGAACAC -3'
(R):5'- TAGGCATGGAGGGTCATCTC -3'

Sequencing Primer
(F):5'- GAGTTCAGACCATGATTGCTCAGC -3'
(R):5'- AGGGTCATCTCCGCCACAC -3'
Posted On2019-05-13