Incidental Mutation 'R7030:Igf2r'
ID546284
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Nameinsulin-like growth factor 2 receptor
SynonymsM6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12682406-12769664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12733866 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 231 (L231P)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: L231P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: L231P

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Hr T C 14: 70,563,684 probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 intron probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTGATCATGCCAGCCACC -3'
(R):5'- GGAAAGGTGGTGGTCTCATC -3'

Sequencing Primer
(F):5'- GATCATGCCAGCCACCCATTAC -3'
(R):5'- TCTCATCCAGAGTGAGCCTCAG -3'
Posted On2019-05-13