Incidental Mutation 'R7032:1700029J07Rik'
ID546383
Institutional Source Beutler Lab
Gene Symbol 1700029J07Rik
Ensembl Gene ENSMUSG00000071103
Gene NameRIKEN cDNA 1700029J07 gene
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001033148; MGI: 1916729

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45953606-45975252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45956437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 282 (S282R)
Ref Sequence ENSEMBL: ENSMUSP00000096383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095323] [ENSMUST00000098786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095323
AA Change: S282R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092961
Gene: ENSMUSG00000071103
AA Change: S282R

DomainStartEndE-ValueType
Pfam:DUF4586 7 297 1.2e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098786
AA Change: S282R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096383
Gene: ENSMUSG00000071103
AA Change: S282R

DomainStartEndE-ValueType
Pfam:DUF4586 8 294 6.8e-114 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in 1700029J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:1700029J07Rik APN 8 45973605 unclassified probably benign
D4043:1700029J07Rik UTSW 8 45956403 missense probably damaging 1.00
R0055:1700029J07Rik UTSW 8 45968161 missense probably damaging 0.99
R0055:1700029J07Rik UTSW 8 45968161 missense probably damaging 0.99
R0894:1700029J07Rik UTSW 8 45956460 missense probably damaging 1.00
R1585:1700029J07Rik UTSW 8 45956478 missense probably benign 0.19
R4513:1700029J07Rik UTSW 8 45968138 missense probably damaging 1.00
R4600:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4601:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4602:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4603:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4610:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4734:1700029J07Rik UTSW 8 45970417 missense possibly damaging 0.58
R4829:1700029J07Rik UTSW 8 45967915 missense probably damaging 1.00
R5259:1700029J07Rik UTSW 8 45962336 missense probably benign 0.04
R7031:1700029J07Rik UTSW 8 45968103 missense probably benign 0.02
R7177:1700029J07Rik UTSW 8 45970407 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCTGGCTTTGTAAAGGACC -3'
(R):5'- CTGGGGTTTGAACAGAATGAATAAC -3'

Sequencing Primer
(F):5'- CTTTGTAAAGGACCCAGCAGAGC -3'
(R):5'- CTCCGTCGGCTAGAAAAGTATATAG -3'
Posted On2019-05-13