Incidental Mutation 'R7032:Rhobtb3'
ID546405
Institutional Source Beutler Lab
Gene Symbol Rhobtb3
Ensembl Gene ENSMUSG00000021589
Gene NameRho-related BTB domain containing 3
Synonyms2610033K01Rik, 4930503C18Rik, 1700040C17Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028493.2; MGI:1920546

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location75869537-75943925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75872394 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 596 (E596D)
Ref Sequence ENSEMBL: ENSMUSP00000022078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022078]
Predicted Effect probably benign
Transcript: ENSMUST00000022078
AA Change: E596D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022078
Gene: ENSMUSG00000021589
AA Change: E596D

DomainStartEndE-ValueType
Pfam:Ras 47 195 9e-7 PFAM
Blast:BTB 254 406 2e-95 BLAST
BTB 420 518 3.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220939
Predicted Effect probably benign
Transcript: ENSMUST00000222923
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RHOBTB3 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (MIM 607351).[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality, reduced body weight and slightly reduced organ weights that varies by sex. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Rhobtb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rhobtb3 APN 13 75877428 missense probably damaging 1.00
IGL02142:Rhobtb3 APN 13 75877495 missense probably damaging 1.00
IGL02708:Rhobtb3 APN 13 75917724 missense probably damaging 0.99
IGL02732:Rhobtb3 APN 13 75910937 missense probably damaging 1.00
IGL02969:Rhobtb3 APN 13 75943431 missense probably damaging 1.00
R0048:Rhobtb3 UTSW 13 75902245 makesense probably null
R0285:Rhobtb3 UTSW 13 75877509 missense possibly damaging 0.86
R2233:Rhobtb3 UTSW 13 75872365 missense possibly damaging 0.76
R2289:Rhobtb3 UTSW 13 75910927 missense probably damaging 0.97
R2332:Rhobtb3 UTSW 13 75910852 missense probably benign 0.44
R3684:Rhobtb3 UTSW 13 75939481 missense probably damaging 1.00
R4685:Rhobtb3 UTSW 13 75878932 nonsense probably null
R5060:Rhobtb3 UTSW 13 75913270 missense probably benign
R5374:Rhobtb3 UTSW 13 75878895 missense probably damaging 0.98
R5688:Rhobtb3 UTSW 13 75872418 missense probably benign 0.01
R6181:Rhobtb3 UTSW 13 75910689 missense probably benign 0.05
R6235:Rhobtb3 UTSW 13 75892910 missense probably damaging 0.99
R6947:Rhobtb3 UTSW 13 75910666 missense probably benign 0.14
R7039:Rhobtb3 UTSW 13 75872453 nonsense probably null
R7148:Rhobtb3 UTSW 13 75910887 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCTTTTAAGACCACCACAG -3'
(R):5'- AGTCCTGATGGCCTTTTACCG -3'

Sequencing Primer
(F):5'- GACCACCACAGTCTTTAAAAGATAAC -3'
(R):5'- CTGATGGCCTTTTACCGATATTC -3'
Posted On2019-05-13