Incidental Mutation 'R7032:Vit'
ID546414
Institutional Source Beutler Lab
Gene Symbol Vit
Ensembl Gene ENSMUSG00000024076
Gene Namevitrin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78508063-78627409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78624865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 467 (D467A)
Ref Sequence ENSEMBL: ENSMUSP00000024880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024880]
Predicted Effect probably damaging
Transcript: ENSMUST00000024880
AA Change: D467A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: D467A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 42 124 2.5e-45 SMART
low complexity region 148 171 N/A INTRINSIC
VWA 263 451 7.34e-39 SMART
VWA 465 641 1.02e-46 SMART
Meta Mutation Damage Score 0.442 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Vit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vit APN 17 78601907 critical splice donor site probably null
IGL00929:Vit APN 17 78579401 missense probably damaging 0.98
IGL01447:Vit APN 17 78625204 missense probably damaging 1.00
IGL02000:Vit APN 17 78605486 missense possibly damaging 0.94
IGL02230:Vit APN 17 78619627 missense probably damaging 1.00
IGL02245:Vit APN 17 78625051 missense probably damaging 1.00
IGL02315:Vit APN 17 78622658 missense possibly damaging 0.80
IGL03133:Vit APN 17 78566071 missense probably benign
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0520:Vit UTSW 17 78625159 missense probably damaging 1.00
R0550:Vit UTSW 17 78624793 missense possibly damaging 0.95
R0565:Vit UTSW 17 78624837 missense probably damaging 1.00
R0856:Vit UTSW 17 78619657 missense possibly damaging 0.53
R1155:Vit UTSW 17 78566027 missense probably damaging 1.00
R1327:Vit UTSW 17 78625200 missense probably damaging 1.00
R1690:Vit UTSW 17 78624865 missense probably damaging 1.00
R1802:Vit UTSW 17 78605511 missense possibly damaging 0.91
R1822:Vit UTSW 17 78622836 missense probably benign 0.01
R1826:Vit UTSW 17 78534676 missense probably benign 0.22
R1827:Vit UTSW 17 78546446 critical splice donor site probably null
R1862:Vit UTSW 17 78622746 missense probably damaging 1.00
R2235:Vit UTSW 17 78605438 missense probably benign 0.01
R2571:Vit UTSW 17 78586745 missense probably benign
R4011:Vit UTSW 17 78534692 splice site probably benign
R4190:Vit UTSW 17 78586826 missense probably benign 0.13
R4191:Vit UTSW 17 78586826 missense probably benign 0.13
R4192:Vit UTSW 17 78586826 missense probably benign 0.13
R4193:Vit UTSW 17 78586826 missense probably benign 0.13
R4635:Vit UTSW 17 78574212 missense probably benign 0.01
R4705:Vit UTSW 17 78625114 missense probably damaging 1.00
R4841:Vit UTSW 17 78601879 missense probably benign
R4842:Vit UTSW 17 78601879 missense probably benign
R4884:Vit UTSW 17 78624753 missense probably damaging 0.99
R4923:Vit UTSW 17 78586841 missense probably benign 0.03
R5128:Vit UTSW 17 78625146 missense probably damaging 1.00
R5272:Vit UTSW 17 78586835 missense probably benign
R5779:Vit UTSW 17 78546426 missense probably benign
R6596:Vit UTSW 17 78622845 missense probably benign 0.35
R6658:Vit UTSW 17 78622803 missense possibly damaging 0.93
R6792:Vit UTSW 17 78579399 missense probably damaging 1.00
R6894:Vit UTSW 17 78626758 nonsense probably null
R7061:Vit UTSW 17 78625156 missense probably damaging 1.00
R7102:Vit UTSW 17 78624997 missense probably damaging 1.00
R7106:Vit UTSW 17 78586799 missense probably benign
R7292:Vit UTSW 17 78605498 missense probably benign 0.03
X0023:Vit UTSW 17 78566164 missense probably benign
X0064:Vit UTSW 17 78624885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGAAGGACTTGACTTCTG -3'
(R):5'- TCCTGATGGCACTGAGGATG -3'

Sequencing Primer
(F):5'- CTGAAGGACTTGACTTCTGATCTG -3'
(R):5'- ATGGCACTGAGGATGTCGGC -3'
Posted On2019-05-13