Incidental Mutation 'R7033:Dusp10'
ID546423
Institutional Source Beutler Lab
Gene Symbol Dusp10
Ensembl Gene ENSMUSG00000039384
Gene Namedual specificity phosphatase 10
SynonymsMKP5, 2610306G15Rik, MKP-5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R7033 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location184013302-184075636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 184037605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000045838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655] [ENSMUST00000050306] [ENSMUST00000139839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048655
AA Change: V256A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384
AA Change: V256A

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050306
SMART Domains Protein: ENSMUSP00000055787
Gene: ENSMUSG00000044854

DomainStartEndE-ValueType
SCOP:d1howa_ 12 46 7e-3 SMART
low complexity region 81 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139839
SMART Domains Protein: ENSMUSP00000121433
Gene: ENSMUSG00000039384

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display alterations in both innate and adaptive immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,997,417 Y105C probably damaging Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Acr T C 15: 89,569,500 S81P probably benign Het
Akr1c14 T C 13: 4,079,178 probably null Het
Ank2 C A 3: 126,944,850 E2375* probably null Het
Avpi1 A G 19: 42,124,977 W14R probably damaging Het
Brd4 A G 17: 32,199,015 V55A probably benign Het
Casp8ap2 A G 4: 32,639,392 N149D probably damaging Het
Ccl25 A T 8: 4,349,641 probably benign Het
Celf5 A G 10: 81,462,714 L299P probably damaging Het
Cfap57 T G 4: 118,613,126 T186P possibly damaging Het
Chrm4 A G 2: 91,928,347 M367V probably benign Het
Col1a2 A T 6: 4,516,904 probably benign Het
Crybg3 G A 16: 59,554,165 P2242L probably damaging Het
Cspg4 T C 9: 56,888,074 V1031A probably damaging Het
Dbnl C A 11: 5,798,102 P313T probably benign Het
Dnah1 A G 14: 31,264,925 F3637L probably damaging Het
Dnah7a A T 1: 53,479,661 I2979N probably damaging Het
Erlin2 T C 8: 27,031,764 V164A probably benign Het
Fam110a T C 2: 151,970,211 D213G probably damaging Het
Fkbp1a T C 2: 151,557,500 probably null Het
Foxg1 G A 12: 49,384,720 probably benign Het
Gm12185 T C 11: 48,915,999 S122G probably benign Het
Gm2042 A T 12: 87,960,281 D456V probably damaging Het
Gm8857 G T 5: 10,950,551 probably null Het
Grin2b A G 6: 135,923,038 Y282H probably damaging Het
Gys2 T C 6: 142,472,722 D27G probably benign Het
H2-DMa T A 17: 34,136,997 probably null Het
Hectd4 T A 5: 121,364,568 I4245N possibly damaging Het
Incenp A G 19: 9,893,372 Y298H unknown Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kifc1 A T 17: 33,883,697 V314E probably damaging Het
Lurap1l C T 4: 80,911,367 P5S probably benign Het
Mtmr11 A G 3: 96,169,946 Y540C probably damaging Het
Muc4 C A 16: 32,756,324 probably benign Het
Myh13 A G 11: 67,369,316 E1860G possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nbeal1 G A 1: 60,310,947 G2385D probably damaging Het
Ncaph2 G A 15: 89,371,356 A578T probably benign Het
Ncr1 T C 7: 4,338,145 V8A possibly damaging Het
Nutm1 T C 2: 112,256,168 T73A probably damaging Het
Olfm1 G A 2: 28,229,336 D313N probably damaging Het
Olfr1196 T A 2: 88,700,820 N170Y probably damaging Het
Olfr275 A G 4: 52,826,089 M231V probably benign Het
Olfr749 A G 14: 50,736,707 F152L possibly damaging Het
Otog T A 7: 46,267,398 probably null Het
Peak1 G T 9: 56,259,707 D312E probably damaging Het
Plekhg1 T C 10: 3,940,251 I331T probably damaging Het
Polr1b T C 2: 129,115,642 V539A possibly damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Ppargc1b G T 18: 61,307,714 A711D probably damaging Het
Prnd T A 2: 131,953,442 C161S possibly damaging Het
Prrt4 A G 6: 29,171,148 L435P possibly damaging Het
Psen2 C T 1: 180,227,520 probably null Het
Psg23 T C 7: 18,614,744 E46G possibly damaging Het
Rasgef1b C T 5: 99,232,336 R350H probably damaging Het
Rfxank G C 8: 70,138,170 P16A probably benign Het
Sema6a A G 18: 47,248,570 I944T probably damaging Het
Serpinc1 A G 1: 160,997,521 T313A probably benign Het
Slc27a4 T C 2: 29,804,271 S36P possibly damaging Het
Slc36a1 C A 11: 55,223,737 R214S probably benign Het
Sorl1 C T 9: 42,030,983 S982N possibly damaging Het
Syt1 A C 10: 108,690,936 D37E probably benign Het
Tcl1b5 A T 12: 105,176,491 D26V probably damaging Het
Tenm4 A T 7: 96,895,223 K2149* probably null Het
Ubc T A 5: 125,388,174 I30F probably damaging Het
Ugt1a7c A T 1: 88,095,528 E136D possibly damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r159 C T 7: 22,842,864 V248I probably damaging Het
Vmn2r105 T C 17: 20,208,612 H734R probably damaging Het
Wdr60 T C 12: 116,211,891 M889V probably benign Het
Xrcc2 T G 5: 25,692,709 I81L possibly damaging Het
Zfat A C 15: 68,181,015 I310S probably damaging Het
Zfp119a A G 17: 55,866,009 V278A probably benign Het
Zfp53 A G 17: 21,500,246 K33E probably benign Het
Zfp866 G T 8: 69,765,841 H376Q probably damaging Het
Other mutations in Dusp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Dusp10 APN 1 184069131 missense probably benign 0.00
IGL01094:Dusp10 APN 1 184037500 unclassified probably null
IGL01380:Dusp10 APN 1 184069014 missense possibly damaging 0.93
FR4449:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4548:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4737:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4976:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
LCD18:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
R0369:Dusp10 UTSW 1 184069056 missense probably damaging 1.00
R0433:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R0464:Dusp10 UTSW 1 184069076 missense probably benign 0.01
R1112:Dusp10 UTSW 1 184036900 missense probably damaging 0.98
R1474:Dusp10 UTSW 1 184037448 unclassified probably null
R1667:Dusp10 UTSW 1 184036858 missense probably damaging 1.00
R1719:Dusp10 UTSW 1 184037225 missense probably benign 0.22
R1899:Dusp10 UTSW 1 184069180 missense possibly damaging 0.64
R5238:Dusp10 UTSW 1 184037013 missense possibly damaging 0.94
R5277:Dusp10 UTSW 1 184037007 missense possibly damaging 0.94
R5742:Dusp10 UTSW 1 184037656 splice site probably null
R5948:Dusp10 UTSW 1 184068876 missense probably benign
R6890:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R6969:Dusp10 UTSW 1 184068888 missense probably damaging 1.00
R7007:Dusp10 UTSW 1 184037217 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCAGGCCTTTCATGGAGTAC -3'
(R):5'- CTTGGGGTTAGAAGAAGGCTGC -3'

Sequencing Primer
(F):5'- AGGAGCTGTCCACATTAACTG -3'
(R):5'- GGCTGCCACTTGTAAGAGAATCTC -3'
Posted On2019-05-13