Incidental Mutation 'R7033:Slc27a4'
ID546425
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7033 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29804271 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080065
AA Change: S36P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: S36P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,997,417 Y105C probably damaging Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Acr T C 15: 89,569,500 S81P probably benign Het
Akr1c14 T C 13: 4,079,178 probably null Het
Ank2 C A 3: 126,944,850 E2375* probably null Het
Avpi1 A G 19: 42,124,977 W14R probably damaging Het
Brd4 A G 17: 32,199,015 V55A probably benign Het
Casp8ap2 A G 4: 32,639,392 N149D probably damaging Het
Ccl25 A T 8: 4,349,641 probably benign Het
Celf5 A G 10: 81,462,714 L299P probably damaging Het
Cfap57 T G 4: 118,613,126 T186P possibly damaging Het
Chrm4 A G 2: 91,928,347 M367V probably benign Het
Col1a2 A T 6: 4,516,904 probably benign Het
Crybg3 G A 16: 59,554,165 P2242L probably damaging Het
Cspg4 T C 9: 56,888,074 V1031A probably damaging Het
Dbnl C A 11: 5,798,102 P313T probably benign Het
Dnah1 A G 14: 31,264,925 F3637L probably damaging Het
Dnah7a A T 1: 53,479,661 I2979N probably damaging Het
Dusp10 T C 1: 184,037,605 V256A possibly damaging Het
Erlin2 T C 8: 27,031,764 V164A probably benign Het
Fam110a T C 2: 151,970,211 D213G probably damaging Het
Fkbp1a T C 2: 151,557,500 probably null Het
Foxg1 G A 12: 49,384,720 probably benign Het
Gm12185 T C 11: 48,915,999 S122G probably benign Het
Gm2042 A T 12: 87,960,281 D456V probably damaging Het
Gm8857 G T 5: 10,950,551 probably null Het
Grin2b A G 6: 135,923,038 Y282H probably damaging Het
Gys2 T C 6: 142,472,722 D27G probably benign Het
H2-DMa T A 17: 34,136,997 probably null Het
Hectd4 T A 5: 121,364,568 I4245N possibly damaging Het
Incenp A G 19: 9,893,372 Y298H unknown Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kifc1 A T 17: 33,883,697 V314E probably damaging Het
Lurap1l C T 4: 80,911,367 P5S probably benign Het
Mtmr11 A G 3: 96,169,946 Y540C probably damaging Het
Muc4 C A 16: 32,756,324 probably benign Het
Myh13 A G 11: 67,369,316 E1860G possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nbeal1 G A 1: 60,310,947 G2385D probably damaging Het
Ncaph2 G A 15: 89,371,356 A578T probably benign Het
Ncr1 T C 7: 4,338,145 V8A possibly damaging Het
Nutm1 T C 2: 112,256,168 T73A probably damaging Het
Olfm1 G A 2: 28,229,336 D313N probably damaging Het
Olfr1196 T A 2: 88,700,820 N170Y probably damaging Het
Olfr275 A G 4: 52,826,089 M231V probably benign Het
Olfr749 A G 14: 50,736,707 F152L possibly damaging Het
Otog T A 7: 46,267,398 probably null Het
Peak1 G T 9: 56,259,707 D312E probably damaging Het
Plekhg1 T C 10: 3,940,251 I331T probably damaging Het
Polr1b T C 2: 129,115,642 V539A possibly damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Ppargc1b G T 18: 61,307,714 A711D probably damaging Het
Prnd T A 2: 131,953,442 C161S possibly damaging Het
Prrt4 A G 6: 29,171,148 L435P possibly damaging Het
Psen2 C T 1: 180,227,520 probably null Het
Psg23 T C 7: 18,614,744 E46G possibly damaging Het
Rasgef1b C T 5: 99,232,336 R350H probably damaging Het
Rfxank G C 8: 70,138,170 P16A probably benign Het
Sema6a A G 18: 47,248,570 I944T probably damaging Het
Serpinc1 A G 1: 160,997,521 T313A probably benign Het
Slc36a1 C A 11: 55,223,737 R214S probably benign Het
Sorl1 C T 9: 42,030,983 S982N possibly damaging Het
Syt1 A C 10: 108,690,936 D37E probably benign Het
Tcl1b5 A T 12: 105,176,491 D26V probably damaging Het
Tenm4 A T 7: 96,895,223 K2149* probably null Het
Ubc T A 5: 125,388,174 I30F probably damaging Het
Ugt1a7c A T 1: 88,095,528 E136D possibly damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r159 C T 7: 22,842,864 V248I probably damaging Het
Vmn2r105 T C 17: 20,208,612 H734R probably damaging Het
Wdr60 T C 12: 116,211,891 M889V probably benign Het
Xrcc2 T G 5: 25,692,709 I81L possibly damaging Het
Zfat A C 15: 68,181,015 I310S probably damaging Het
Zfp119a A G 17: 55,866,009 V278A probably benign Het
Zfp53 A G 17: 21,500,246 K33E probably benign Het
Zfp866 G T 8: 69,765,841 H376Q probably damaging Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0688:Slc27a4 UTSW 2 29812615 missense probably damaging 1.00
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R2056:Slc27a4 UTSW 2 29810941 missense probably damaging 0.99
R4901:Slc27a4 UTSW 2 29812636 missense probably damaging 1.00
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7301:Slc27a4 UTSW 2 29812932 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TCATACTGAAGTGGCTGCTG -3'
(R):5'- TTGAGACCTTGACCTTGGAGATG -3'

Sequencing Primer
(F):5'- TGCTGGTGCAGAAGTAGC -3'
(R):5'- GACCTTGACCTTGGAGATGAAAGTTC -3'
Posted On2019-05-13