Incidental Mutation 'R7033:Brd4'
ID546486
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Namebromodomain containing 4
SynonymsHUNK1, MCAP, WI-11513
Accession Numbers

Genbank: NM_020508.3; NM_198094.2; MGI: 1888520

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7033 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32196274-32284722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32199015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000155477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000121285] [ENSMUST00000230858]
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: V1146A
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: V1146A

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: V1145A
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: V1145A

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230858
AA Change: V55A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype Strain: 2674141
Lethality: E3-E8
FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,997,417 Y105C probably damaging Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Acr T C 15: 89,569,500 S81P probably benign Het
Akr1c14 T C 13: 4,079,178 probably null Het
Ank2 C A 3: 126,944,850 E2375* probably null Het
Avpi1 A G 19: 42,124,977 W14R probably damaging Het
Casp8ap2 A G 4: 32,639,392 N149D probably damaging Het
Ccl25 A T 8: 4,349,641 probably benign Het
Celf5 A G 10: 81,462,714 L299P probably damaging Het
Cfap57 T G 4: 118,613,126 T186P possibly damaging Het
Chrm4 A G 2: 91,928,347 M367V probably benign Het
Col1a2 A T 6: 4,516,904 probably benign Het
Crybg3 G A 16: 59,554,165 P2242L probably damaging Het
Cspg4 T C 9: 56,888,074 V1031A probably damaging Het
Dbnl C A 11: 5,798,102 P313T probably benign Het
Dnah1 A G 14: 31,264,925 F3637L probably damaging Het
Dnah7a A T 1: 53,479,661 I2979N probably damaging Het
Dusp10 T C 1: 184,037,605 V256A possibly damaging Het
Erlin2 T C 8: 27,031,764 V164A probably benign Het
Fam110a T C 2: 151,970,211 D213G probably damaging Het
Fkbp1a T C 2: 151,557,500 probably null Het
Foxg1 G A 12: 49,384,720 probably benign Het
Gm12185 T C 11: 48,915,999 S122G probably benign Het
Gm2042 A T 12: 87,960,281 D456V probably damaging Het
Gm8857 G T 5: 10,950,551 probably null Het
Grin2b A G 6: 135,923,038 Y282H probably damaging Het
Gys2 T C 6: 142,472,722 D27G probably benign Het
H2-DMa T A 17: 34,136,997 probably null Het
Hectd4 T A 5: 121,364,568 I4245N possibly damaging Het
Incenp A G 19: 9,893,372 Y298H unknown Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kifc1 A T 17: 33,883,697 V314E probably damaging Het
Lurap1l C T 4: 80,911,367 P5S probably benign Het
Mtmr11 A G 3: 96,169,946 Y540C probably damaging Het
Muc4 C A 16: 32,756,324 probably benign Het
Myh13 A G 11: 67,369,316 E1860G possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nbeal1 G A 1: 60,310,947 G2385D probably damaging Het
Ncaph2 G A 15: 89,371,356 A578T probably benign Het
Ncr1 T C 7: 4,338,145 V8A possibly damaging Het
Nutm1 T C 2: 112,256,168 T73A probably damaging Het
Olfm1 G A 2: 28,229,336 D313N probably damaging Het
Olfr1196 T A 2: 88,700,820 N170Y probably damaging Het
Olfr275 A G 4: 52,826,089 M231V probably benign Het
Olfr749 A G 14: 50,736,707 F152L possibly damaging Het
Otog T A 7: 46,267,398 probably null Het
Peak1 G T 9: 56,259,707 D312E probably damaging Het
Plekhg1 T C 10: 3,940,251 I331T probably damaging Het
Polr1b T C 2: 129,115,642 V539A possibly damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Ppargc1b G T 18: 61,307,714 A711D probably damaging Het
Prnd T A 2: 131,953,442 C161S possibly damaging Het
Prrt4 A G 6: 29,171,148 L435P possibly damaging Het
Psen2 C T 1: 180,227,520 probably null Het
Psg23 T C 7: 18,614,744 E46G possibly damaging Het
Rasgef1b C T 5: 99,232,336 R350H probably damaging Het
Rfxank G C 8: 70,138,170 P16A probably benign Het
Sema6a A G 18: 47,248,570 I944T probably damaging Het
Serpinc1 A G 1: 160,997,521 T313A probably benign Het
Slc27a4 T C 2: 29,804,271 S36P possibly damaging Het
Slc36a1 C A 11: 55,223,737 R214S probably benign Het
Sorl1 C T 9: 42,030,983 S982N possibly damaging Het
Syt1 A C 10: 108,690,936 D37E probably benign Het
Tcl1b5 A T 12: 105,176,491 D26V probably damaging Het
Tenm4 A T 7: 96,895,223 K2149* probably null Het
Ubc T A 5: 125,388,174 I30F probably damaging Het
Ugt1a7c A T 1: 88,095,528 E136D possibly damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r159 C T 7: 22,842,864 V248I probably damaging Het
Vmn2r105 T C 17: 20,208,612 H734R probably damaging Het
Wdr60 T C 12: 116,211,891 M889V probably benign Het
Xrcc2 T G 5: 25,692,709 I81L possibly damaging Het
Zfat A C 15: 68,181,015 I310S probably damaging Het
Zfp119a A G 17: 55,866,009 V278A probably benign Het
Zfp53 A G 17: 21,500,246 K33E probably benign Het
Zfp866 G T 8: 69,765,841 H376Q probably damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32198675 splice site probably benign
IGL01758:Brd4 APN 17 32212829 unclassified probably benign
IGL02750:Brd4 APN 17 32198379 unclassified probably benign
IGL03066:Brd4 APN 17 32199088 intron probably benign
IGL03338:Brd4 APN 17 32213072 missense probably damaging 1.00
H8562:Brd4 UTSW 17 32229403 splice site probably benign
P0035:Brd4 UTSW 17 32212838 critical splice donor site probably null
R0243:Brd4 UTSW 17 32224123 missense probably benign 0.15
R0281:Brd4 UTSW 17 32213540 unclassified probably benign
R0331:Brd4 UTSW 17 32202515 missense probably benign 0.01
R0722:Brd4 UTSW 17 32212982 missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32220252 missense probably benign 0.09
R1544:Brd4 UTSW 17 32198672 splice site probably benign
R1920:Brd4 UTSW 17 32198086 unclassified probably benign
R1922:Brd4 UTSW 17 32198086 unclassified probably benign
R1957:Brd4 UTSW 17 32221366 missense possibly damaging 0.50
R2240:Brd4 UTSW 17 32213639 unclassified probably benign
R2316:Brd4 UTSW 17 32212910 missense probably benign 0.03
R2333:Brd4 UTSW 17 32221457 missense probably damaging 0.97
R3809:Brd4 UTSW 17 32211270 missense possibly damaging 0.72
R4273:Brd4 UTSW 17 32214782 missense probably benign
R4595:Brd4 UTSW 17 32198922 missense probably damaging 0.97
R4854:Brd4 UTSW 17 32220237 missense probably damaging 0.96
R4923:Brd4 UTSW 17 32199240 missense probably benign 0.38
R5014:Brd4 UTSW 17 32198398 unclassified probably benign
R5757:Brd4 UTSW 17 32201298 unclassified probably benign
R5979:Brd4 UTSW 17 32198726 missense probably benign 0.32
R6212:Brd4 UTSW 17 32202449 missense probably damaging 0.98
R6394:Brd4 UTSW 17 32224147 nonsense probably null
R6643:Brd4 UTSW 17 32198496 missense unknown
R7024:Brd4 UTSW 17 32221910 utr 3 prime probably benign
R7220:Brd4 UTSW 17 32225583 missense unknown
X0064:Brd4 UTSW 17 32201127 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTATGTGAGTCTGGGTCACC -3'
(R):5'- CTCAGATGCCACAGTTCCAG -3'

Sequencing Primer
(F):5'- TCTGGGTCACCTGGAAGATGC -3'
(R):5'- ATGCCACAGTTCCAGAGCCTG -3'
Posted On2019-05-13