Incidental Mutation 'R7033:Ppargc1b'
ID546490
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 beta
SynonymsPGC-1beta/ERRL1, 4631412G21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R7033 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61298136-61400431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61307714 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 711 (A711D)
Ref Sequence ENSEMBL: ENSMUSP00000069431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
Predicted Effect probably damaging
Transcript: ENSMUST00000063307
AA Change: A711D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: A711D

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075299
AA Change: A695D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: A695D

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,997,417 Y105C probably damaging Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Acr T C 15: 89,569,500 S81P probably benign Het
Akr1c14 T C 13: 4,079,178 probably null Het
Ank2 C A 3: 126,944,850 E2375* probably null Het
Avpi1 A G 19: 42,124,977 W14R probably damaging Het
Brd4 A G 17: 32,199,015 V55A probably benign Het
Casp8ap2 A G 4: 32,639,392 N149D probably damaging Het
Ccl25 A T 8: 4,349,641 probably benign Het
Celf5 A G 10: 81,462,714 L299P probably damaging Het
Cfap57 T G 4: 118,613,126 T186P possibly damaging Het
Chrm4 A G 2: 91,928,347 M367V probably benign Het
Col1a2 A T 6: 4,516,904 probably benign Het
Crybg3 G A 16: 59,554,165 P2242L probably damaging Het
Cspg4 T C 9: 56,888,074 V1031A probably damaging Het
Dbnl C A 11: 5,798,102 P313T probably benign Het
Dnah1 A G 14: 31,264,925 F3637L probably damaging Het
Dnah7a A T 1: 53,479,661 I2979N probably damaging Het
Dusp10 T C 1: 184,037,605 V256A possibly damaging Het
Erlin2 T C 8: 27,031,764 V164A probably benign Het
Fam110a T C 2: 151,970,211 D213G probably damaging Het
Fkbp1a T C 2: 151,557,500 probably null Het
Foxg1 G A 12: 49,384,720 probably benign Het
Gm12185 T C 11: 48,915,999 S122G probably benign Het
Gm2042 A T 12: 87,960,281 D456V probably damaging Het
Gm8857 G T 5: 10,950,551 probably null Het
Grin2b A G 6: 135,923,038 Y282H probably damaging Het
Gys2 T C 6: 142,472,722 D27G probably benign Het
H2-DMa T A 17: 34,136,997 probably null Het
Hectd4 T A 5: 121,364,568 I4245N possibly damaging Het
Incenp A G 19: 9,893,372 Y298H unknown Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kifc1 A T 17: 33,883,697 V314E probably damaging Het
Lurap1l C T 4: 80,911,367 P5S probably benign Het
Mtmr11 A G 3: 96,169,946 Y540C probably damaging Het
Muc4 C A 16: 32,756,324 probably benign Het
Myh13 A G 11: 67,369,316 E1860G possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nbeal1 G A 1: 60,310,947 G2385D probably damaging Het
Ncaph2 G A 15: 89,371,356 A578T probably benign Het
Ncr1 T C 7: 4,338,145 V8A possibly damaging Het
Nutm1 T C 2: 112,256,168 T73A probably damaging Het
Olfm1 G A 2: 28,229,336 D313N probably damaging Het
Olfr1196 T A 2: 88,700,820 N170Y probably damaging Het
Olfr275 A G 4: 52,826,089 M231V probably benign Het
Olfr749 A G 14: 50,736,707 F152L possibly damaging Het
Otog T A 7: 46,267,398 probably null Het
Peak1 G T 9: 56,259,707 D312E probably damaging Het
Plekhg1 T C 10: 3,940,251 I331T probably damaging Het
Polr1b T C 2: 129,115,642 V539A possibly damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prnd T A 2: 131,953,442 C161S possibly damaging Het
Prrt4 A G 6: 29,171,148 L435P possibly damaging Het
Psen2 C T 1: 180,227,520 probably null Het
Psg23 T C 7: 18,614,744 E46G possibly damaging Het
Rasgef1b C T 5: 99,232,336 R350H probably damaging Het
Rfxank G C 8: 70,138,170 P16A probably benign Het
Sema6a A G 18: 47,248,570 I944T probably damaging Het
Serpinc1 A G 1: 160,997,521 T313A probably benign Het
Slc27a4 T C 2: 29,804,271 S36P possibly damaging Het
Slc36a1 C A 11: 55,223,737 R214S probably benign Het
Sorl1 C T 9: 42,030,983 S982N possibly damaging Het
Syt1 A C 10: 108,690,936 D37E probably benign Het
Tcl1b5 A T 12: 105,176,491 D26V probably damaging Het
Tenm4 A T 7: 96,895,223 K2149* probably null Het
Ubc T A 5: 125,388,174 I30F probably damaging Het
Ugt1a7c A T 1: 88,095,528 E136D possibly damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r159 C T 7: 22,842,864 V248I probably damaging Het
Vmn2r105 T C 17: 20,208,612 H734R probably damaging Het
Wdr60 T C 12: 116,211,891 M889V probably benign Het
Xrcc2 T G 5: 25,692,709 I81L possibly damaging Het
Zfat A C 15: 68,181,015 I310S probably damaging Het
Zfp119a A G 17: 55,866,009 V278A probably benign Het
Zfp53 A G 17: 21,500,246 K33E probably benign Het
Zfp866 G T 8: 69,765,841 H376Q probably damaging Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61323164 missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61310435 missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61310875 nonsense probably null
IGL02176:Ppargc1b APN 18 61310874 missense probably damaging 1.00
IGL02183:Ppargc1b APN 18 61309096 critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61323151 missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61298739 missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61312243 missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61307684 missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61298766 missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61307694 missense probably damaging 1.00
R0139:Ppargc1b UTSW 18 61315963 splice site probably benign
R0194:Ppargc1b UTSW 18 61307945 missense possibly damaging 0.94
R0412:Ppargc1b UTSW 18 61315861 missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61302739 missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61311441 missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61310606 missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61307204 splice site probably null
R1758:Ppargc1b UTSW 18 61298786 splice site probably null
R1951:Ppargc1b UTSW 18 61298777 missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2112:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61311220 nonsense probably null
R2432:Ppargc1b UTSW 18 61307799 missense possibly damaging 0.93
R3612:Ppargc1b UTSW 18 61310556 missense probably benign 0.07
R3848:Ppargc1b UTSW 18 61311042 missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61311376 missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61382469 nonsense probably null
R4502:Ppargc1b UTSW 18 61302679 missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61311257 missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61307265 missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61310487 missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61307654 missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61302644 missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61315805 missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61309063 missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61307568 missense probably benign
R5719:Ppargc1b UTSW 18 61307568 missense probably benign
R5876:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61298766 missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6135:Ppargc1b UTSW 18 61315909 missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61307774 missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R7316:Ppargc1b UTSW 18 61307838 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGGATCTCATGGTCTCTTAGC -3'
(R):5'- TCCATACAAGCCAATGGAGGAG -3'

Sequencing Primer
(F):5'- ATGGTCTCTTAGCTGCATGC -3'
(R):5'- AATGGAGGAGGACCCCTTC -3'
Posted On2019-05-13