Incidental Mutation 'R7037:Dclk1'
ID546752
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Namedoublecortin-like kinase 1
Synonyms2810480F11Rik, Dcamkl1, CPG16, Click-I, Dcl, DCLK, 1700113D08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019978; MGI: 1330861

Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location55242364-55539068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55463048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000143507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000070418] [ENSMUST00000167204] [ENSMUST00000179544] [ENSMUST00000196745] [ENSMUST00000198412] [ENSMUST00000198437] [ENSMUST00000199169] [ENSMUST00000199585] [ENSMUST00000199702] [ENSMUST00000200352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054237
AA Change: S330P

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797
AA Change: S330P

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070418
AA Change: S23P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070292
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 1.71e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167204
AA Change: S330P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129334
Gene: ENSMUSG00000027797
AA Change: S330P

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179544
Predicted Effect probably benign
Transcript: ENSMUST00000196745
AA Change: S330P

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797
AA Change: S330P

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198412
AA Change: S23P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142637
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 339 8.1e-107 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198437
AA Change: S23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143016
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 99 356 1.71e-104 SMART
low complexity region 429 440 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199169
AA Change: S23P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143563
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.5e-107 SMART
Predicted Effect unknown
Transcript: ENSMUST00000199585
AA Change: S23P
SMART Domains Protein: ENSMUSP00000142698
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 44 56 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199702
AA Change: S23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143507
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 82 339 8.5e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200352
AA Change: S23P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142840
Gene: ENSMUSG00000027797
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.3e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55247286 missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55500099 missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55487787 splice site probably benign
IGL03086:Dclk1 APN 3 55247367 missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55480384 nonsense probably null
R0037:Dclk1 UTSW 3 55256059 missense probably benign 0.02
R0316:Dclk1 UTSW 3 55502892 missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55487307 missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55380823 missense probably benign 0.05
R1234:Dclk1 UTSW 3 55489877 missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55477823 missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55247521 missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55521925 critical splice donor site probably null
R2152:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55480433 missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55247442 missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55247329 missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55247410 missense probably damaging 1.00
R4851:Dclk1 UTSW 3 55480390 missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55521932 missense probably benign
R5105:Dclk1 UTSW 3 55255939 missense probably benign 0.00
R5175:Dclk1 UTSW 3 55247227 missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55255945 missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55516939 missense probably benign 0.15
R5819:Dclk1 UTSW 3 55489864 missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55489819 missense probably benign 0.00
R6162:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R6190:Dclk1 UTSW 3 55487811 missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55516871 critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55247194 missense probably damaging 1.00
R6406:Dclk1 UTSW 3 55480406 missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55500131 missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55477808 missense probably damaging 1.00
R6970:Dclk1 UTSW 3 55466601 intron probably benign
R7086:Dclk1 UTSW 3 55487912 critical splice donor site probably null
R7163:Dclk1 UTSW 3 55256128 nonsense probably null
R7198:Dclk1 UTSW 3 55477875 missense possibly damaging 0.70
Z1088:Dclk1 UTSW 3 55500105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGTGTCTGAAGATGGCTATTC -3'
(R):5'- TGATCCACAGCAGGTTACCC -3'

Sequencing Primer
(F):5'- CTGAAGATGGCTATTCCCTAAGGC -3'
(R):5'- ACAGCAGGTTACCCTTGCC -3'
Posted On2019-05-13