Incidental Mutation 'R7037:Cttnbp2'
ID546764
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R7037 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18435118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 247 (E247G)
Ref Sequence ENSEMBL: ENSMUSP00000118432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000148602]
Predicted Effect probably damaging
Transcript: ENSMUST00000090601
AA Change: E247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129669
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146775
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148602
AA Change: E247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: E247G

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACATCTGTCTGGCAAGCAACG -3'
(R):5'- TAAGCAGCTCTCGGGCAAAG -3'

Sequencing Primer
(F):5'- AGCAACGGACCTTGTCACAGG -3'
(R):5'- AGCTCTCGGGCAAAGTCGTG -3'
Posted On2019-05-13