Incidental Mutation 'R7037:Fam71e2'
ID546766
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Namefamily with sequence similarity 71, member E2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4753226-4771302 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to T at 4758585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163574] [ENSMUST00000174409]
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: S376Y

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R0981:Fam71e2 UTSW 7 4757589 unclassified probably null
R1428:Fam71e2 UTSW 7 4757688 missense possibly damaging 0.68
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5491:Fam71e2 UTSW 7 4757926 missense probably benign 0.05
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6025:Fam71e2 UTSW 7 4758144 missense probably benign 0.01
R6038:Fam71e2 UTSW 7 4753595 unclassified probably null
R6038:Fam71e2 UTSW 7 4753595 unclassified probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6371:Fam71e2 UTSW 7 4759359 missense probably benign 0.06
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7381:Fam71e2 UTSW 7 4757682 missense
Predicted Primers PCR Primer
(F):5'- TCTTGACCACAGTGCAGTCG -3'
(R):5'- TGGAAACTCCTTCAAAGTGCC -3'

Sequencing Primer
(F):5'- ACAGTGCAGTCGGGGTCTTC -3'
(R):5'- GCCTTTCTCAGAACAGCACTGG -3'
Posted On2019-05-13