Incidental Mutation 'R7037:Foxred1'
ID546774
Institutional Source Beutler Lab
Gene Symbol Foxred1
Ensembl Gene ENSMUSG00000039048
Gene NameFAD-dependent oxidoreductase domain containing 1
SynonymsTex23, TEG-23
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35204206-35211055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35207548 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 223 (S223T)
Ref Sequence ENSEMBL: ENSMUSP00000038924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000135054] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043805
AA Change: S223T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048
AA Change: S223T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127996
AA Change: S223T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048
AA Change: S223T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135054
SMART Domains Protein: ENSMUSP00000115301
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
Pfam:DAO 3 140 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142595
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Foxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02163:Foxred1 APN 9 35205896 missense probably damaging 1.00
IGL02314:Foxred1 APN 9 35205968 missense probably damaging 1.00
IGL02379:Foxred1 APN 9 35209986 missense probably benign 0.44
IGL02558:Foxred1 APN 9 35210133 missense probably damaging 1.00
PIT4494001:Foxred1 UTSW 9 35209059 missense possibly damaging 0.95
R0220:Foxred1 UTSW 9 35209453 missense probably damaging 1.00
R0605:Foxred1 UTSW 9 35204882 missense possibly damaging 0.68
R0763:Foxred1 UTSW 9 35207473 splice site probably null
R1136:Foxred1 UTSW 9 35205037 missense probably benign 0.25
R1449:Foxred1 UTSW 9 35209442 missense probably damaging 1.00
R1757:Foxred1 UTSW 9 35210834 missense probably benign 0.16
R2157:Foxred1 UTSW 9 35205363 missense probably damaging 1.00
R2434:Foxred1 UTSW 9 35205658 missense probably damaging 0.99
R3713:Foxred1 UTSW 9 35210890 start codon destroyed probably null
R4012:Foxred1 UTSW 9 35206275 missense possibly damaging 0.48
R4666:Foxred1 UTSW 9 35210855 intron probably benign
R4934:Foxred1 UTSW 9 35209914 intron probably benign
R5488:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5489:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5828:Foxred1 UTSW 9 35210196 intron probably benign
R5840:Foxred1 UTSW 9 35210139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTAGCAGAAGATGGCCTC -3'
(R):5'- CAAACCATGCTACTTCTCTGGC -3'

Sequencing Primer
(F):5'- TTAGCAGAAGATGGCCTCTCACAC -3'
(R):5'- CTCTGGCCTTCAGCATGAC -3'
Posted On2019-05-13