Incidental Mutation 'R7037:Baiap3'
ID546795
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene NameBAI1-associated protein 3
SynonymsLOC381076
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7037 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25242659-25256364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25243840 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1075 (R1075C)
Ref Sequence ENSEMBL: ENSMUSP00000138254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038973] [ENSMUST00000063574] [ENSMUST00000115154] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: R1088C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182056
AA Change: R1111C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: R1111C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182435
AA Change: R1083C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: R1083C

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182696
Predicted Effect probably benign
Transcript: ENSMUST00000182825
AA Change: R1075C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: R1075C

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25244328 missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25248377 splice site probably benign
IGL00820:Baiap3 APN 17 25248690 missense probably benign 0.20
IGL01443:Baiap3 APN 17 25245147 missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25249377 missense probably benign 0.11
IGL02341:Baiap3 APN 17 25248316 missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25244348 missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25244502 splice site probably benign
IGL02993:Baiap3 APN 17 25250082 critical splice donor site probably null
R0021:Baiap3 UTSW 17 25243669 missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25250070 splice site probably benign
R0276:Baiap3 UTSW 17 25243687 missense probably damaging 1.00
R0488:Baiap3 UTSW 17 25248470 critical splice donor site probably null
R0826:Baiap3 UTSW 17 25245229 missense possibly damaging 0.89
R0883:Baiap3 UTSW 17 25249101 missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25249328 missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25244805 missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25250404 missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25244575 missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25249536 missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25246670 missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25250261 missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25247295 splice site probably benign
R4979:Baiap3 UTSW 17 25246362 missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25250269 missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25245342 missense probably benign 0.01
R5566:Baiap3 UTSW 17 25251733 missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25251475 missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25249373 missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25247524 missense probably benign 0.01
R5743:Baiap3 UTSW 17 25244785 missense probably benign 0.02
R5805:Baiap3 UTSW 17 25247515 missense probably benign 0.12
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25248470 critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25245758 missense probably benign 0.00
R6700:Baiap3 UTSW 17 25244026 missense probably damaging 1.00
R7038:Baiap3 UTSW 17 25243840 missense probably benign
R7039:Baiap3 UTSW 17 25243840 missense probably benign
R7126:Baiap3 UTSW 17 25245145 missense possibly damaging 0.64
X0017:Baiap3 UTSW 17 25248350 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTATGACCATCAAGGCGCTC -3'
(R):5'- CGATGAACTCTTCCACTTGTGAG -3'

Sequencing Primer
(F):5'- ATCAAGGCGCTCAGAGGTC -3'
(R):5'- ACTTGTGAGTGCCTGCC -3'
Posted On2019-05-13