Incidental Mutation 'R7037:Bicral'
ID546797
Institutional Source Beutler Lab
Gene Symbol Bicral
Ensembl Gene ENSMUSG00000036568
Gene NameBRD4 interacting chromatin remodeling complex associated protein like
SynonymsBC032203, Gltscr1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46798116-46831413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46824634 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 550 (H550R)
Ref Sequence ENSEMBL: ENSMUSP00000044833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040624]
Predicted Effect probably benign
Transcript: ENSMUST00000040624
AA Change: H550R

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: H550R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Pfam:GLTSCR1 701 808 4.5e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Bicral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Bicral APN 17 46825352 missense probably benign 0.01
IGL01068:Bicral APN 17 46825391 missense probably damaging 1.00
IGL01899:Bicral APN 17 46824674 missense probably benign 0.08
IGL02321:Bicral APN 17 46811947 missense probably benign 0.01
IGL02425:Bicral APN 17 46808454 missense probably benign 0.05
R0091:Bicral UTSW 17 46825307 missense probably damaging 1.00
R0268:Bicral UTSW 17 46814052 splice site probably benign
R0344:Bicral UTSW 17 46814052 splice site probably benign
R0508:Bicral UTSW 17 46825401 missense possibly damaging 0.61
R0589:Bicral UTSW 17 46801596 missense probably benign 0.00
R1442:Bicral UTSW 17 46801724 missense probably benign 0.05
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1874:Bicral UTSW 17 46825178 missense probably benign 0.30
R2057:Bicral UTSW 17 46824888 missense possibly damaging 0.69
R2120:Bicral UTSW 17 46824815 missense probably benign 0.02
R2190:Bicral UTSW 17 46825123 missense probably damaging 0.98
R3737:Bicral UTSW 17 46825910 missense probably damaging 1.00
R3961:Bicral UTSW 17 46824825 missense probably damaging 0.96
R3977:Bicral UTSW 17 46830991 start codon destroyed unknown
R3979:Bicral UTSW 17 46830991 start codon destroyed unknown
R4183:Bicral UTSW 17 46814029 missense probably damaging 1.00
R4876:Bicral UTSW 17 46825576 missense probably damaging 1.00
R5104:Bicral UTSW 17 46801256 missense probably damaging 0.98
R5310:Bicral UTSW 17 46813983 missense possibly damaging 0.89
R5493:Bicral UTSW 17 46801694 missense possibly damaging 0.77
R5610:Bicral UTSW 17 46808492 missense probably damaging 0.99
R5656:Bicral UTSW 17 46808369 missense probably damaging 0.99
R5771:Bicral UTSW 17 46825358 missense possibly damaging 0.59
R5891:Bicral UTSW 17 46801229 missense probably benign
R6426:Bicral UTSW 17 46830079 missense probably benign 0.36
R6497:Bicral UTSW 17 46825573 missense probably damaging 1.00
R7025:Bicral UTSW 17 46801668 missense probably benign
V3553:Bicral UTSW 17 46830095 missense probably damaging 1.00
X0019:Bicral UTSW 17 46825821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGAACTGCTGCTGTGTCC -3'
(R):5'- GACTTTTGCCACCTCTGGAAGTC -3'

Sequencing Primer
(F):5'- CCCGGGGTGTTGCTCAAG -3'
(R):5'- TGGAAGTCCAGTGATAGTCAACCAC -3'
Posted On2019-05-13