Incidental Mutation 'R7038:Fndc3b'
ID546828
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27501469 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 312 (G312D)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000193779] [ENSMUST00000195008]
Predicted Effect probably benign
Transcript: ENSMUST00000046157
AA Change: G312D

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: G312D

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193779
AA Change: G108D
SMART Domains Protein: ENSMUSP00000141888
Gene: ENSMUSG00000039286
AA Change: G108D

DomainStartEndE-ValueType
PDB:1WK0|A 67 117 2e-6 PDB
Blast:FN3 75 119 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195008
AA Change: G312D

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: G312D

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7102:Fndc3b UTSW 3 27470234 missense possibly damaging 0.73
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATCCAGGGTTGCATGCAC -3'
(R):5'- GGCTTCTGGAAAGTGCCATTG -3'

Sequencing Primer
(F):5'- ATGCACGCTAGGCTGATG -3'
(R):5'- CTGGAAAGTGCCATTGTTTACC -3'
Posted On2019-05-13