Incidental Mutation 'R7038:Htr1b'
ID546863
Institutional Source Beutler Lab
Gene Symbol Htr1b
Ensembl Gene ENSMUSG00000049511
Gene Name5-hydroxytryptamine (serotonin) receptor 1B
Synonyms5-HT1B receptor, 5-HT<1B> receptor, 5HT1B receptor
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location81628291-81633828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81632243 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 104 (M104L)
Ref Sequence ENSEMBL: ENSMUSP00000139389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051005] [ENSMUST00000183482]
Predicted Effect probably benign
Transcript: ENSMUST00000051005
AA Change: M104L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050898
Gene: ENSMUSG00000049511
AA Change: M104L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 6e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183482
AA Change: M104L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139389
Gene: ENSMUSG00000049511
AA Change: M104L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 5.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an increase in body weight, aggression, drinking behavior, and osteoblast proliferation and bone mass, and show altered spatial learning and operant conditional behavior as well as reduced anxiety-related response and startle reflex, and small testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Htr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Htr1b APN 9 81631636 missense probably damaging 1.00
IGL03144:Htr1b APN 9 81631945 missense probably damaging 0.96
IGL03350:Htr1b APN 9 81632122 missense probably damaging 1.00
R0395:Htr1b UTSW 9 81631651 missense probably benign 0.09
R0697:Htr1b UTSW 9 81631463 missense possibly damaging 0.77
R1569:Htr1b UTSW 9 81632287 missense probably benign 0.01
R3411:Htr1b UTSW 9 81632041 missense probably benign 0.00
R3821:Htr1b UTSW 9 81632434 missense probably benign 0.02
R4359:Htr1b UTSW 9 81632351 missense probably benign 0.12
R4487:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4489:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4715:Htr1b UTSW 9 81631510 missense possibly damaging 0.95
R5502:Htr1b UTSW 9 81631801 missense possibly damaging 0.82
R6393:Htr1b UTSW 9 81631757 missense probably benign 0.11
R6616:Htr1b UTSW 9 81632434 missense probably benign
R6900:Htr1b UTSW 9 81631570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGATGGCCGCCCTTTTG -3'
(R):5'- CGGCTACATTTACCAGGACTCC -3'

Sequencing Primer
(F):5'- GGGAGTCCTTTTAGCAGAATACTCC -3'
(R):5'- TGCCCTGGAAAGTCCTGCTG -3'
Posted On2019-05-13