Incidental Mutation 'R7038:Utrn'
ID546867
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12682338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1459 (H1459R)
Ref Sequence ENSEMBL: ENSMUSP00000151431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
Predicted Effect probably damaging
Transcript: ENSMUST00000076817
AA Change: H1459R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: H1459R

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218635
AA Change: H1459R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGGGAGAGCCACAGTTC -3'
(R):5'- AATTCCTCTGGGGTTTCCTG -3'

Sequencing Primer
(F):5'- GAGAGCCACAGTTCTTTTTGTTC -3'
(R):5'- TTTTGAAAAGTCTTTCGGCATTATG -3'
Posted On2019-05-13