Incidental Mutation 'R7038:Prpf8'
ID546873
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75496158 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1143 (M1143K)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
Predicted Effect probably benign
Transcript: ENSMUST00000018449
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: M1143K

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102510
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: M1143K

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
PIT4514001:Prpf8 UTSW 11 75496355 missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 unclassified probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 unclassified probably null
R5186:Prpf8 UTSW 11 75489783 missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75503643 missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75491495 missense probably benign 0.33
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGAGTTAGTTCTCAAAGGGTCC -3'
(R):5'- TGATGTCCCAGAACACTGCC -3'

Sequencing Primer
(F):5'- CTCAAAGGGTCCTAGTATATTTGGAG -3'
(R):5'- TATCCAGAGAACACAGAGGCACTTC -3'
Posted On2019-05-13