Incidental Mutation 'R7038:Mrc2'
ID546876
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105332236 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 435 (E435G)
Ref Sequence ENSEMBL: ENSMUSP00000021038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021038
AA Change: E435G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: E435G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100335
AA Change: E435G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: E435G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTTAGCATCCACAGCATG -3'
(R):5'- GGTGCTATTATGAGAAAGGAAAGTCTC -3'

Sequencing Primer
(F):5'- GCTGAGCTGGAGTTCATCAC -3'
(R):5'- AGGAAAGTCTCACCGGCC -3'
Posted On2019-05-13