Incidental Mutation 'R7038:Unc5a'
ID546883
Institutional Source Beutler Lab
Gene Symbol Unc5a
Ensembl Gene ENSMUSG00000025876
Gene Nameunc-5 netrin receptor A
SynonymsUnc5h1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54949411-55006018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55004484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 62 (R62G)
Ref Sequence ENSEMBL: ENSMUSP00000115531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000052949] [ENSMUST00000109994] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000136852] [ENSMUST00000137967] [ENSMUST00000153665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026994
AA Change: R787G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: R787G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052949
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109994
AA Change: R731G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: R731G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123097
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126234
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132309
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136852
SMART Domains Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
TSP1 20 70 1.23e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137967
AA Change: R62G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876
AA Change: R62G

DomainStartEndE-ValueType
PDB:3G5B|A 1 118 6e-36 PDB
Blast:DEATH 80 119 9e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153665
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Unc5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Unc5a APN 13 54995820 missense probably benign 0.00
IGL00339:Unc5a APN 13 54995815 missense possibly damaging 0.89
IGL00924:Unc5a APN 13 55004514 missense probably damaging 0.99
IGL01411:Unc5a APN 13 55002928 missense probably damaging 1.00
IGL01511:Unc5a APN 13 55004816 missense probably damaging 0.97
IGL02430:Unc5a APN 13 55002482 missense probably damaging 1.00
IGL02996:Unc5a APN 13 54996178 missense probably damaging 0.99
IGL03188:Unc5a APN 13 54999503 missense probably damaging 0.98
PIT1430001:Unc5a UTSW 13 55003896 missense probably damaging 1.00
PIT4378001:Unc5a UTSW 13 54995868 missense possibly damaging 0.95
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0028:Unc5a UTSW 13 55003913 missense possibly damaging 0.70
R0505:Unc5a UTSW 13 55004954 missense probably damaging 1.00
R0744:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R0745:Unc5a UTSW 13 55005255 frame shift probably null
R0836:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R1018:Unc5a UTSW 13 54990952 missense possibly damaging 0.81
R1432:Unc5a UTSW 13 55004472 unclassified probably benign
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1691:Unc5a UTSW 13 55002924 missense probably damaging 1.00
R2132:Unc5a UTSW 13 54991083 missense probably damaging 0.96
R4020:Unc5a UTSW 13 55003369 missense probably damaging 1.00
R4080:Unc5a UTSW 13 55004481 missense possibly damaging 0.62
R4720:Unc5a UTSW 13 55003883 missense probably null 1.00
R4876:Unc5a UTSW 13 54997229 missense probably benign
R4953:Unc5a UTSW 13 54999870 missense probably benign 0.02
R5112:Unc5a UTSW 13 55003418 critical splice donor site probably null
R5593:Unc5a UTSW 13 55004934 missense possibly damaging 0.91
R5903:Unc5a UTSW 13 54999690 missense possibly damaging 0.92
R6521:Unc5a UTSW 13 55004935 missense probably benign 0.01
R6723:Unc5a UTSW 13 54995889 missense probably benign 0.23
R7065:Unc5a UTSW 13 54991083 missense probably damaging 1.00
R7241:Unc5a UTSW 13 54991020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGCATAGCCATGGATG -3'
(R):5'- CCTGTCCAGGTGAAGTTTCTGG -3'

Sequencing Primer
(F):5'- GAGGTGTTCTCCGTCACCAAC -3'
(R):5'- TCTGGGCTAGAGTTCGCCAG -3'
Posted On2019-05-13