Incidental Mutation 'R7038:Med15'
ID546891
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Namemediator complex subunit 15
SynonymsPcqap, A230074L19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17651208-17732891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17652727 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 589 (D589N)
Ref Sequence ENSEMBL: ENSMUSP00000156242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000056962] [ENSMUST00000080936] [ENSMUST00000182117] [ENSMUST00000182344] [ENSMUST00000182368] [ENSMUST00000231674] [ENSMUST00000232236] [ENSMUST00000232645]
Predicted Effect probably benign
Transcript: ENSMUST00000012259
AA Change: D739N

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: D739N

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080936
AA Change: D699N

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: D699N

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182344
SMART Domains Protein: ENSMUSP00000138131
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
Pfam:CCDC92 18 79 1.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182368
SMART Domains Protein: ENSMUSP00000138262
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 49 110 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect probably benign
Transcript: ENSMUST00000231674
Predicted Effect possibly damaging
Transcript: ENSMUST00000232236
AA Change: D739N

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232645
AA Change: D589N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gcn1l1 G A 5: 115,611,144 V1912I probably damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17680726 missense probably damaging 0.96
IGL00780:Med15 APN 16 17653487 missense probably damaging 1.00
IGL02365:Med15 APN 16 17671606 intron probably benign
R0324:Med15 UTSW 16 17697612 missense probably damaging 0.98
R1225:Med15 UTSW 16 17722788 missense probably damaging 1.00
R1695:Med15 UTSW 16 17722780 missense probably damaging 0.96
R1745:Med15 UTSW 16 17655706 unclassified probably benign
R1801:Med15 UTSW 16 17680735 missense possibly damaging 0.66
R1838:Med15 UTSW 16 17653562 missense probably benign 0.11
R1901:Med15 UTSW 16 17673154 unclassified probably benign
R2153:Med15 UTSW 16 17685451 critical splice donor site probably null
R2974:Med15 UTSW 16 17652711 missense probably damaging 1.00
R3808:Med15 UTSW 16 17655734 unclassified probably benign
R3809:Med15 UTSW 16 17655734 unclassified probably benign
R4240:Med15 UTSW 16 17655494 missense probably damaging 1.00
R4483:Med15 UTSW 16 17671564 intron probably benign
R4484:Med15 UTSW 16 17671564 intron probably benign
R4577:Med15 UTSW 16 17674515 nonsense probably null
R5652:Med15 UTSW 16 17655191 missense probably damaging 1.00
R6244:Med15 UTSW 16 17652745 nonsense probably null
R6701:Med15 UTSW 16 17671583 intron probably benign
R6793:Med15 UTSW 16 17652703 unclassified probably benign
R7036:Med15 UTSW 16 17698155 start codon destroyed probably null
R7211:Med15 UTSW 16 17698113 missense unknown
R7317:Med15 UTSW 16 17671643 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTTACATGAGCACCTACTGG -3'
(R):5'- ACCCTGTAGAGTGTAGAGAGC -3'

Sequencing Primer
(F):5'- GCCCTGGGACACTTTGTAG -3'
(R):5'- TAGAGAGCCTTTTTAGGAGCAG -3'
Posted On2019-05-13