Incidental Mutation 'R7041:Hspe1'
ID547034
Institutional Source Beutler Lab
Gene Symbol Hspe1
Ensembl Gene ENSMUSG00000073676
Gene Nameheat shock protein 1 (chaperonin 10)
Synonymsmitochondrial chaperonin 10, Hsp10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location55088132-55091307 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55089217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027123] [ENSMUST00000075242] [ENSMUST00000127861] [ENSMUST00000144077]
Predicted Effect probably benign
Transcript: ENSMUST00000027123
SMART Domains Protein: ENSMUSP00000027123
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 550 1.8e-87 PFAM
low complexity region 557 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075242
SMART Domains Protein: ENSMUSP00000074724
Gene: ENSMUSG00000073676

DomainStartEndE-ValueType
Cpn10 8 100 2.91e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127861
SMART Domains Protein: ENSMUSP00000119336
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 202 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144077
SMART Domains Protein: ENSMUSP00000122947
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 142 1.2e-32 PFAM
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Hspe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Hspe1 APN 1 55089042 unclassified probably benign
IGL02977:Hspe1 APN 1 55091073 missense probably benign 0.30
Shock UTSW 1 55090701 splice site probably null
R4712:Hspe1 UTSW 1 55089110 missense probably benign 0.00
R6279:Hspe1 UTSW 1 55090701 splice site probably null
R6300:Hspe1 UTSW 1 55090701 splice site probably null
R7121:Hspe1 UTSW 1 55089151 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCTCTCCACAGGCTGGAC -3'
(R):5'- CTACACAGCATATAGACATGTGC -3'

Sequencing Primer
(F):5'- CTGGACAAGCTTTTAGGAAGTTTC -3'
(R):5'- AATACCTTTTGCCTTTCTTCAGAAAC -3'
Posted On2019-05-13