Incidental Mutation 'R7041:Cav1'
ID547049
Institutional Source Beutler Lab
Gene Symbol Cav1
Ensembl Gene ENSMUSG00000007655
Gene Namecaveolin 1, caveolae protein
Synonymscaveolin-1, Cav-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location17306335-17341452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17339144 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000120252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007799] [ENSMUST00000115453] [ENSMUST00000115454] [ENSMUST00000115455] [ENSMUST00000115456] [ENSMUST00000123439] [ENSMUST00000177234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007799
AA Change: E76G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007799
Gene: ENSMUSG00000007655
AA Change: E76G

DomainStartEndE-ValueType
Pfam:Caveolin 27 177 4.1e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115453
AA Change: E45G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111113
Gene: ENSMUSG00000007655
AA Change: E45G

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115454
AA Change: E45G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111114
Gene: ENSMUSG00000007655
AA Change: E45G

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115455
AA Change: E65G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111115
Gene: ENSMUSG00000007655
AA Change: E65G

DomainStartEndE-ValueType
Pfam:Caveolin 16 115 2.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115456
AA Change: E76G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111116
Gene: ENSMUSG00000007655
AA Change: E76G

DomainStartEndE-ValueType
Pfam:Caveolin 42 175 1.1e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123439
AA Change: E45G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000177234
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous targeted mutants displayed vascular system dysfunctions and thickening of lung aveloar septa from hyperproliferation and fibrosis, ultimately causing the mice physical limitations. Mice also display increased incidence of calcium calculi, kidney stones, and decreased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Cav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Cav1 APN 6 17307972 missense possibly damaging 0.93
R0113:Cav1 UTSW 6 17308049 missense possibly damaging 0.60
R0149:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R0361:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R1706:Cav1 UTSW 6 17339182 missense probably damaging 0.96
R1930:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R1931:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R2166:Cav1 UTSW 6 17339431 missense possibly damaging 0.69
R2655:Cav1 UTSW 6 17339360 missense probably damaging 1.00
R4416:Cav1 UTSW 6 17339249 missense probably benign 0.36
R4460:Cav1 UTSW 6 17306472 missense probably damaging 0.99
R5204:Cav1 UTSW 6 17339255 missense probably damaging 1.00
R5956:Cav1 UTSW 6 17307919 missense probably damaging 1.00
R6467:Cav1 UTSW 6 17308035 missense probably damaging 0.99
X0026:Cav1 UTSW 6 17339162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATATTCATGTTCCCAGTGAGG -3'
(R):5'- CGGCTGATGCACTGAATCTC -3'

Sequencing Primer
(F):5'- ATTCATGTTCCCAGTGAGGTCCAAG -3'
(R):5'- AAGCTCTTGATGCACGGTAC -3'
Posted On2019-05-13