Incidental Mutation 'R7041:Ripor2'
ID 547071
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene Name RHO family interacting cell polarization regulator 2
Synonyms 1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik
MMRRC Submission 045140-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R7041 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 24685513-24917789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24877749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 250 (I250V)
Ref Sequence ENSEMBL: ENSMUSP00000043663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
AlphaFold Q80U16
Predicted Effect probably benign
Transcript: ENSMUST00000038477
AA Change: I250V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: I250V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058009
AA Change: I250V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: I250V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091694
AA Change: I253V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: I253V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110383
AA Change: I225V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: I225V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110384
AA Change: I250V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: I250V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 78,748,096 (GRCm39) E956* probably null Het
Adam25 A T 8: 41,207,121 (GRCm39) H129L probably benign Het
Adgrl4 A T 3: 151,144,959 (GRCm39) H36L probably benign Het
Ago1 T A 4: 126,357,499 (GRCm39) I59F possibly damaging Het
Anapc1 A T 2: 128,470,576 (GRCm39) V1518E possibly damaging Het
Atxn1 A G 13: 45,720,311 (GRCm39) I528T probably damaging Het
B4galnt4 A G 7: 140,650,593 (GRCm39) H820R probably damaging Het
Cacna1h T C 17: 25,612,977 (GRCm39) E282G probably damaging Het
Camk1 T A 6: 113,316,475 (GRCm39) M95L probably benign Het
Capn7 C T 14: 31,058,642 (GRCm39) probably benign Het
Cav1 A G 6: 17,339,143 (GRCm39) E45G possibly damaging Het
Ccdc183 T G 2: 25,503,682 (GRCm39) E185A probably benign Het
Ccl2 T A 11: 81,926,489 (GRCm39) M1K probably null Het
Cep97 T A 16: 55,726,117 (GRCm39) H590L probably benign Het
Dsg1c A T 18: 20,399,201 (GRCm39) I102F probably damaging Het
Fcho2 A G 13: 98,921,334 (GRCm39) Y184H possibly damaging Het
Gart C T 16: 91,440,031 (GRCm39) probably benign Het
Gask1a A T 9: 121,794,467 (GRCm39) Q207L probably damaging Het
Golga3 G A 5: 110,356,450 (GRCm39) probably null Het
Hint3 G T 10: 30,486,380 (GRCm39) A133E probably damaging Het
Hspe1 T C 1: 55,128,376 (GRCm39) probably null Het
Insr A T 8: 3,308,418 (GRCm39) V206E probably benign Het
Insrr T C 3: 87,722,551 (GRCm39) S1258P probably damaging Het
Itga11 C T 9: 62,659,538 (GRCm39) T430M probably damaging Het
Jmjd1c G A 10: 67,056,388 (GRCm39) V890I possibly damaging Het
Kdm4b T A 17: 56,703,592 (GRCm39) S717R probably damaging Het
Large1 A T 8: 73,843,092 (GRCm39) C144S probably damaging Het
Lrat G T 3: 82,810,755 (GRCm39) Q89K probably benign Het
Lrrc66 A T 5: 73,765,899 (GRCm39) F381L possibly damaging Het
Myo15a A G 11: 60,396,832 (GRCm39) T2634A probably damaging Het
Nup205 T G 6: 35,201,470 (GRCm39) I1182M possibly damaging Het
Or2a51 T A 6: 43,178,837 (GRCm39) D86E probably benign Het
Or5m10 A T 2: 85,717,965 (GRCm39) I274F probably benign Het
Or6c66 T A 10: 129,461,603 (GRCm39) E109V probably damaging Het
Plekha6 T A 1: 133,200,198 (GRCm39) V259D possibly damaging Het
Prdm9 C A 17: 15,765,257 (GRCm39) A508S possibly damaging Het
Prickle2 A G 6: 92,353,286 (GRCm39) F783L probably benign Het
Ptprc T C 1: 138,054,047 (GRCm39) S31G probably benign Het
Rbak A T 5: 143,159,226 (GRCm39) I609N probably damaging Het
Rimklb A T 6: 122,436,176 (GRCm39) L134* probably null Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spaca6 C T 17: 18,056,358 (GRCm39) L118F probably benign Het
Tmem167 G A 13: 90,246,533 (GRCm39) C19Y probably benign Het
Togaram1 C T 12: 65,067,160 (GRCm39) T1684I possibly damaging Het
Trappc8 T C 18: 21,007,729 (GRCm39) T129A probably benign Het
Ubash3a A G 17: 31,447,184 (GRCm39) S347G probably benign Het
Unc80 T C 1: 66,542,752 (GRCm39) S289P probably benign Het
Vmn2r11 A G 5: 109,202,816 (GRCm39) I87T probably damaging Het
Vmn2r54 A T 7: 12,363,751 (GRCm39) F381I probably damaging Het
Wdsub1 A G 2: 59,683,224 (GRCm39) L450P probably damaging Het
Xylt2 A G 11: 94,558,408 (GRCm39) probably null Het
Zfp429 A T 13: 67,538,830 (GRCm39) C205S probably damaging Het
Zfp60 T C 7: 27,448,451 (GRCm39) I373T probably benign Het
Zfp738 A G 13: 67,818,420 (GRCm39) S524P probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24,885,190 (GRCm39) missense probably benign 0.11
IGL02145:Ripor2 APN 13 24,901,554 (GRCm39) missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24,879,549 (GRCm39) splice site probably benign
IGL02533:Ripor2 APN 13 24,885,378 (GRCm39) nonsense probably null
IGL02798:Ripor2 APN 13 24,858,649 (GRCm39) missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24,879,681 (GRCm39) missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24,880,512 (GRCm39) missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24,907,702 (GRCm39) missense probably damaging 1.00
gentleman UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
Jack UTSW 13 24,861,824 (GRCm39) nonsense probably null
whitechapel UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R0045:Ripor2 UTSW 13 24,878,209 (GRCm39) missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24,864,615 (GRCm39) missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24,864,627 (GRCm39) missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24,878,169 (GRCm39) missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24,861,824 (GRCm39) nonsense probably null
R1374:Ripor2 UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R1564:Ripor2 UTSW 13 24,859,768 (GRCm39) missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24,885,237 (GRCm39) missense probably benign 0.10
R1889:Ripor2 UTSW 13 24,877,870 (GRCm39) missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24,897,701 (GRCm39) missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24,905,817 (GRCm39) critical splice donor site probably null
R2209:Ripor2 UTSW 13 24,885,595 (GRCm39) missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24,855,755 (GRCm39) missense probably benign 0.08
R2392:Ripor2 UTSW 13 24,890,206 (GRCm39) missense probably benign 0.00
R2994:Ripor2 UTSW 13 24,885,610 (GRCm39) missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24,880,521 (GRCm39) missense probably benign
R4287:Ripor2 UTSW 13 24,908,992 (GRCm39) missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4365:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4366:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4868:Ripor2 UTSW 13 24,878,124 (GRCm39) missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24,858,649 (GRCm39) missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24,798,627 (GRCm39) start gained probably benign
R6157:Ripor2 UTSW 13 24,885,052 (GRCm39) missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24,894,113 (GRCm39) missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24,861,828 (GRCm39) missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24,859,803 (GRCm39) missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24,890,215 (GRCm39) missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24,855,829 (GRCm39) missense probably benign 0.00
R7196:Ripor2 UTSW 13 24,888,808 (GRCm39) missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24,855,886 (GRCm39) missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24,885,427 (GRCm39) nonsense probably null
R7417:Ripor2 UTSW 13 24,880,533 (GRCm39) missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24,878,188 (GRCm39) missense probably benign 0.01
R7448:Ripor2 UTSW 13 24,854,054 (GRCm39) missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24,880,290 (GRCm39) missense unknown
R7499:Ripor2 UTSW 13 24,877,755 (GRCm39) missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24,897,683 (GRCm39) missense probably benign 0.01
R8157:Ripor2 UTSW 13 24,879,600 (GRCm39) missense probably benign 0.05
R8364:Ripor2 UTSW 13 24,894,176 (GRCm39) missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24,907,771 (GRCm39) missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24,849,451 (GRCm39) intron probably benign
R8751:Ripor2 UTSW 13 24,885,050 (GRCm39) missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24,901,651 (GRCm39) missense possibly damaging 0.93
R8867:Ripor2 UTSW 13 24,822,760 (GRCm39) intron probably benign
R9079:Ripor2 UTSW 13 24,915,637 (GRCm39) missense probably benign 0.35
R9187:Ripor2 UTSW 13 24,897,632 (GRCm39) missense probably benign 0.01
R9316:Ripor2 UTSW 13 24,905,719 (GRCm39) missense probably benign 0.09
R9320:Ripor2 UTSW 13 24,915,663 (GRCm39) missense probably damaging 1.00
R9355:Ripor2 UTSW 13 24,885,694 (GRCm39) missense probably benign 0.00
R9655:Ripor2 UTSW 13 24,908,983 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGCACTCCTAAACTGGTCCAG -3'
(R):5'- TGCACACAGAGAGACCTATGG -3'

Sequencing Primer
(F):5'- GGTCCAGATTTGTTACAACACGGC -3'
(R):5'- ATCATTGGGCCAGGACACCAG -3'
Posted On 2019-05-13