Incidental Mutation 'R7041:Prdm9'
ID547080
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene NamePR domain containing 9
SynonymsDsbc1, repro7, Rcr1, Meisetz, G1-419-29
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15543079-15564354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15544995 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 508 (A508S)
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167994
AA Change: A508S

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: A508S

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15553346 missense probably benign 0.11
IGL02322:Prdm9 APN 17 15562848 missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15563260 missense probably benign 0.07
IGL03120:Prdm9 APN 17 15544931 missense probably benign
berlin UTSW 17 15562440 missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R0173:Prdm9 UTSW 17 15544035 missense probably benign 0.00
R0309:Prdm9 UTSW 17 15557384 missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15544376 missense probably damaging 1.00
R3498:Prdm9 UTSW 17 15562945 splice site probably benign
R3714:Prdm9 UTSW 17 15557361 nonsense probably null
R4118:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R4369:Prdm9 UTSW 17 15544446 missense probably benign 0.14
R4691:Prdm9 UTSW 17 15553378 missense probably benign 0.03
R4742:Prdm9 UTSW 17 15553521 missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15544323 missense probably benign 0.08
R5056:Prdm9 UTSW 17 15562417 missense possibly damaging 0.93
R5130:Prdm9 UTSW 17 15544467 missense probably benign 0.00
R5175:Prdm9 UTSW 17 15557451 missense probably benign 0.04
R5187:Prdm9 UTSW 17 15562893 missense probably damaging 0.98
R5213:Prdm9 UTSW 17 15555154 missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15553363 missense probably benign 0.16
R5635:Prdm9 UTSW 17 15562440 missense probably damaging 0.96
R6753:Prdm9 UTSW 17 15544956 missense probably benign 0.00
R6857:Prdm9 UTSW 17 15544256 missense probably benign 0.04
R7355:Prdm9 UTSW 17 15545235 missense probably benign 0.01
R7410:Prdm9 UTSW 17 15544997 missense possibly damaging 0.73
X0021:Prdm9 UTSW 17 15553472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAACATAGGGCTTCTCC -3'
(R):5'- AGCTTCAGGAACAACATGTTG -3'

Sequencing Primer
(F):5'- GGCTTCTCCCCTGTGTGTG -3'
(R):5'- GCTTCAGGAACAACATGTTGATTCAC -3'
Posted On2019-05-13