Incidental Mutation 'R7041:Dsg1c'
ID547085
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20266144 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 102 (I102F)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: I102F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: I102F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGACCATGTATCTACTGTTTC -3'
(R):5'- CTCAGAAGGTCCAGTATTGAGAC -3'

Sequencing Primer
(F):5'- ACTCCTAGGTGATGTCATAGCAC -3'
(R):5'- CAGAAGGTCCAGTATTGAGACTCTTG -3'
Posted On2019-05-13