Incidental Mutation 'R7042:Smc6'
ID547124
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7042 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11309300 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 975 (I975K)
Ref Sequence ENSEMBL: ENSMUSP00000020931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000218022]
Predicted Effect probably damaging
Transcript: ENSMUST00000020931
AA Change: I975K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: I975K

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,098 S554G possibly damaging Het
Adcy7 G T 8: 88,315,750 R415L probably damaging Het
Aox1 A T 1: 58,102,600 I1182F probably damaging Het
Ccdc7b T A 8: 129,085,249 Y147N probably benign Het
Clcnka A G 4: 141,391,380 I398T probably damaging Het
Cst8 T A 2: 148,799,876 probably null Het
Dcxr T C 11: 120,727,015 D45G possibly damaging Het
Dhx38 A T 8: 109,556,985 M510K possibly damaging Het
Ebf1 T A 11: 44,991,511 H431Q probably damaging Het
Eml4 T C 17: 83,461,570 I681T probably damaging Het
Etf1 T C 18: 34,910,166 N164S probably benign Het
Fmo2 A G 1: 162,880,657 V303A probably damaging Het
Foxl2 T A 9: 98,955,662 M1K probably null Het
Gm3404 A T 5: 146,526,159 E50D probably benign Het
Gpr61 G A 3: 108,151,331 P5S possibly damaging Het
Hcrtr1 A G 4: 130,130,860 probably benign Het
Ier3ip1 T A 18: 76,930,132 F3I possibly damaging Het
Ifi206 G A 1: 173,481,242 P396L Het
Ifi209 G A 1: 173,642,670 V275I probably benign Het
Ighv1-69 T C 12: 115,623,289 S75G probably benign Het
Kcnj3 A T 2: 55,594,865 H325L possibly damaging Het
Klrk1 A T 6: 129,616,771 S50T possibly damaging Het
Mfsd4b4 T A 10: 39,892,518 Y193F probably damaging Het
Nlrp5 A G 7: 23,417,480 I210V possibly damaging Het
Olfr1135 A T 2: 87,671,591 Y259N possibly damaging Het
Olfr1181 T A 2: 88,423,402 I208F possibly damaging Het
Olfr147 G T 9: 38,402,900 G6C probably damaging Het
Olfr930 A G 9: 38,930,326 S52G possibly damaging Het
Pax6 A T 2: 105,696,373 H208L probably benign Het
Pgc C A 17: 47,733,820 Q331K probably benign Het
Phldb1 A G 9: 44,694,424 S370P probably damaging Het
Pi4k2a T C 19: 42,104,898 I226T probably benign Het
Pick1 T C 15: 79,248,765 S342P probably damaging Het
Plscr1 A G 9: 92,271,535 M312V probably damaging Het
Ppp3cc T G 14: 70,225,019 K399Q probably benign Het
Qpctl T C 7: 19,147,018 H163R probably benign Het
Rab11fip5 A G 6: 85,374,128 V134A possibly damaging Het
Rasal1 T A 5: 120,663,960 probably null Het
Rem2 T A 14: 54,478,091 I171N probably damaging Het
Sec22a T A 16: 35,329,515 I214L probably benign Het
Setbp1 T C 18: 79,086,855 D54G probably damaging Het
Slc27a2 C T 2: 126,567,780 A294V probably damaging Het
Slfn14 T A 11: 83,276,604 D695V probably damaging Het
Spice1 T C 16: 44,385,680 F835L probably benign Het
Tars2 A T 3: 95,750,745 H222Q probably benign Het
Tmtc2 A T 10: 105,370,616 F273I probably damaging Het
Ttc39d C A 17: 80,216,462 D183E probably benign Het
Vasp A G 7: 19,262,021 S128P probably benign Het
Vcpip1 A G 1: 9,748,153 S2P unknown Het
Vmn2r98 T C 17: 19,080,922 Y729H probably benign Het
Wdr18 A T 10: 79,966,110 D243V probably benign Het
Wdr60 T C 12: 116,254,441 I182M probably benign Het
Xirp2 T C 2: 67,513,289 V1958A probably benign Het
Zfp451 A T 1: 33,777,393 M492K probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGAAATGGTCTTAAATCCACC -3'
(R):5'- TGGATTGGCAAGGTAAACTCTTG -3'

Sequencing Primer
(F):5'- GGTGTTTGACATTACGATGC -3'
(R):5'- TCTCTGGGAAGAAACTCTAGGCTAC -3'
Posted On2019-05-13