Incidental Mutation 'R7043:Cd53'
ID547149
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene NameCD53 antigen
SynonymsTspan25, Ox-44
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106759921-106790149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106763261 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 152 (D152G)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
Predicted Effect probably damaging
Transcript: ENSMUST00000038845
AA Change: D152G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: D152G

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106768826 missense probably damaging 1.00
IGL02592:Cd53 APN 3 106763285 missense probably damaging 1.00
R0090:Cd53 UTSW 3 106767409 missense possibly damaging 0.94
R0392:Cd53 UTSW 3 106763276 missense probably damaging 1.00
R0538:Cd53 UTSW 3 106762128 missense probably benign 0.07
R1452:Cd53 UTSW 3 106768959 missense probably damaging 1.00
R1693:Cd53 UTSW 3 106768889 missense possibly damaging 0.66
R2042:Cd53 UTSW 3 106767424 critical splice acceptor site probably null
R2300:Cd53 UTSW 3 106763256 missense probably benign
R2878:Cd53 UTSW 3 106767416 missense probably benign 0.00
R4081:Cd53 UTSW 3 106762145 missense probably benign
R6180:Cd53 UTSW 3 106767364 missense probably damaging 0.96
R6519:Cd53 UTSW 3 106762145 missense probably benign 0.00
R6694:Cd53 UTSW 3 106767386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCCTAGATTTTGGAAGCATC -3'
(R):5'- TCTGTAGCAGTAGACCAATTCTG -3'

Sequencing Primer
(F):5'- GAGCGGTTCCCTGCTCATTC -3'
(R):5'- AGCAGTAGACCAATTCTGAATTTTC -3'
Posted On2019-05-13