Incidental Mutation 'R7043:Vmn2r11'
ID547153
Institutional Source Beutler Lab
Gene Symbol Vmn2r11
Ensembl Gene ENSMUSG00000091450
Gene Namevomeronasal 2, receptor 11
SynonymsEG384219
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109046873-109059452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109052232 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 452 (I452V)
Ref Sequence ENSEMBL: ENSMUSP00000133218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164875]
Predicted Effect probably benign
Transcript: ENSMUST00000164875
AA Change: I452V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: I452V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 167 475 1.6e-29 PFAM
Pfam:NCD3G 520 574 9.1e-19 PFAM
Pfam:7tm_3 607 842 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Vmn2r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn2r11 APN 5 109047019 missense probably benign 0.00
IGL01677:Vmn2r11 APN 5 109053957 missense possibly damaging 0.50
IGL02048:Vmn2r11 APN 5 109054792 missense probably benign 0.00
IGL02559:Vmn2r11 APN 5 109052180 missense probably damaging 0.98
IGL02879:Vmn2r11 APN 5 109053838 missense possibly damaging 0.95
IGL03084:Vmn2r11 APN 5 109059343 missense probably benign 0.00
IGL03163:Vmn2r11 APN 5 109053826 missense probably benign 0.41
IGL03289:Vmn2r11 APN 5 109048922 splice site probably benign
IGL03294:Vmn2r11 APN 5 109054069 missense probably benign 0.22
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0421:Vmn2r11 UTSW 5 109059428 missense probably benign 0.00
R0549:Vmn2r11 UTSW 5 109052097 missense possibly damaging 0.80
R0628:Vmn2r11 UTSW 5 109047731 missense possibly damaging 0.88
R1523:Vmn2r11 UTSW 5 109053841 missense probably benign 0.25
R1660:Vmn2r11 UTSW 5 109053858 missense possibly damaging 0.79
R1827:Vmn2r11 UTSW 5 109052072 missense probably benign 0.01
R1913:Vmn2r11 UTSW 5 109054788 missense probably benign
R2260:Vmn2r11 UTSW 5 109053791 nonsense probably null
R2400:Vmn2r11 UTSW 5 109052062 missense probably benign 0.03
R3933:Vmn2r11 UTSW 5 109053394 missense probably damaging 0.97
R4091:Vmn2r11 UTSW 5 109054750 critical splice donor site probably null
R4624:Vmn2r11 UTSW 5 109052235 missense probably damaging 0.99
R4762:Vmn2r11 UTSW 5 109047570 missense probably damaging 1.00
R5256:Vmn2r11 UTSW 5 109054792 missense probably benign 0.26
R5370:Vmn2r11 UTSW 5 109047555 missense probably damaging 1.00
R5419:Vmn2r11 UTSW 5 109059358 missense possibly damaging 0.55
R5516:Vmn2r11 UTSW 5 109047166 missense probably damaging 0.98
R5643:Vmn2r11 UTSW 5 109047003 missense probably damaging 1.00
R5671:Vmn2r11 UTSW 5 109054906 missense probably benign 0.03
R5679:Vmn2r11 UTSW 5 109054842 missense probably benign 0.00
R5739:Vmn2r11 UTSW 5 109059248 critical splice donor site probably null
R5746:Vmn2r11 UTSW 5 109053694 missense probably benign 0.41
R5995:Vmn2r11 UTSW 5 109047055 missense probably damaging 1.00
R6147:Vmn2r11 UTSW 5 109054834 missense probably benign 0.04
R6220:Vmn2r11 UTSW 5 109053568 missense probably benign 0.09
R6374:Vmn2r11 UTSW 5 109053813 missense possibly damaging 0.65
R6491:Vmn2r11 UTSW 5 109048934 missense possibly damaging 0.95
R6804:Vmn2r11 UTSW 5 109053484 missense probably damaging 1.00
R6814:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R6872:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R7014:Vmn2r11 UTSW 5 109053423 missense probably damaging 1.00
R7041:Vmn2r11 UTSW 5 109054950 missense probably damaging 1.00
R7050:Vmn2r11 UTSW 5 109054791 missense probably benign 0.05
R7184:Vmn2r11 UTSW 5 109053415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGACCCACTCCAAATCTTCAG -3'
(R):5'- TCTAGCACATTTCACCATGGAAC -3'

Sequencing Primer
(F):5'- CAGATATATGAAGTTGCTGGCTCC -3'
(R):5'- CTTTAATACTGCTGGGGTT -3'
Posted On2019-05-13