Incidental Mutation 'R7043:F7'
ID547157
Institutional Source Beutler Lab
Gene Symbol F7
Ensembl Gene ENSMUSG00000031443
Gene Namecoagulation factor VII
SynonymsFVII, Cf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13026034-13035809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13033997 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 227 (R227S)
Ref Sequence ENSEMBL: ENSMUSP00000033820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033820] [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
Predicted Effect probably benign
Transcript: ENSMUST00000033820
AA Change: R227S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033820
Gene: ENSMUSG00000031443
AA Change: R227S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
GLA 23 86 5.41e-30 SMART
EGF_CA 87 123 2.58e-8 SMART
EGF 131 169 1.99e0 SMART
Tryp_SPc 193 428 1.14e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033821
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128418
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152034
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent serine protease that plays a critical role in the extrinsic pathway of blood coagulation. Upon contact with tissue factor III (TF III), the encoded protein forms an activated complex termed TF-FVIIa that initiates the coagulation cascade involving other coagulation factors, ultimately resulting in a fibrin clot. Complete lack of the encoded protein in mice results in in perinatal lethality due to bleeding from normal blood vessels. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation developed normally through embryogenesis, and exhibited no vascular defects; however, 70% of homozygous neonates suffered fatal intra-abdominal haemorrhaging and died within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in F7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:F7 APN 8 13028802 missense probably benign 0.11
IGL01012:F7 APN 8 13033409 missense probably damaging 0.99
IGL01461:F7 APN 8 13032245 missense possibly damaging 0.94
IGL01700:F7 APN 8 13028685 missense probably benign 0.02
IGL03105:F7 APN 8 13034001 missense probably null 0.07
IGL03241:F7 APN 8 13028779 missense probably damaging 1.00
R0746:F7 UTSW 8 13034740 missense probably benign 0.02
R1587:F7 UTSW 8 13034783 missense possibly damaging 0.95
R1661:F7 UTSW 8 13035209 missense probably benign
R2065:F7 UTSW 8 13035183 missense probably damaging 1.00
R2905:F7 UTSW 8 13034775 missense probably benign 0.02
R4355:F7 UTSW 8 13034774 missense probably benign
R5256:F7 UTSW 8 13030763 missense probably damaging 1.00
R6115:F7 UTSW 8 13033958 missense probably benign 0.01
R6330:F7 UTSW 8 13035140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTACCAGAGCCAGCAG -3'
(R):5'- GCCACTCTTGAAGATATCACCTGG -3'

Sequencing Primer
(F):5'- AGCAGATCTAGGGCTGCTCTAC -3'
(R):5'- CACCTGGTTAGAGACATTGTCAG -3'
Posted On2019-05-13