Incidental Mutation 'R7043:Wwox'
ID547161
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene NameWW domain-containing oxidoreductase
Synonyms9030416C10Rik, WOX1, 5330426P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location114439655-115352708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114679838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 190 (V190L)
Ref Sequence ENSEMBL: ENSMUSP00000104736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]
Predicted Effect probably damaging
Transcript: ENSMUST00000004756
AA Change: V190L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: V190L

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109108
AA Change: V190L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: V190L

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160862
AA Change: V190L

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: V190L

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 114445378 nonsense probably null
IGL02156:Wwox APN 8 114448159 critical splice acceptor site probably null
IGL02267:Wwox APN 8 114712065 missense probably benign 0.23
IGL02346:Wwox APN 8 114712118 missense probably benign 0.11
IGL02350:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02357:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02586:Wwox APN 8 114712207 missense possibly damaging 0.59
IGL02701:Wwox APN 8 114706368 missense probably damaging 1.00
IGL02743:Wwox APN 8 115351704 missense probably damaging 1.00
IGL02804:Wwox APN 8 114712013 missense probably damaging 1.00
IGL02805:Wwox APN 8 114712013 missense probably damaging 1.00
R0048:Wwox UTSW 8 114439830 missense probably damaging 1.00
R0140:Wwox UTSW 8 114706287 missense probably damaging 1.00
R0390:Wwox UTSW 8 114706278 missense probably benign 0.08
R1146:Wwox UTSW 8 114712036 missense possibly damaging 0.95
R1146:Wwox UTSW 8 114712036 missense possibly damaging 0.95
R1193:Wwox UTSW 8 114679874 missense probably benign
R1520:Wwox UTSW 8 114712133 missense probably benign 0.36
R1552:Wwox UTSW 8 114445350 nonsense probably null
R1628:Wwox UTSW 8 114448233 missense probably benign
R1639:Wwox UTSW 8 114445378 nonsense probably null
R3778:Wwox UTSW 8 114874607 missense probably benign 0.00
R3967:Wwox UTSW 8 114488933 missense probably damaging 1.00
R4077:Wwox UTSW 8 114439741 utr 5 prime probably benign
R4876:Wwox UTSW 8 114448248 missense probably damaging 1.00
R4936:Wwox UTSW 8 114706358 missense probably benign 0.00
R5868:Wwox UTSW 8 114679846 missense probably benign
R5988:Wwox UTSW 8 114706341 missense probably benign 0.06
R6272:Wwox UTSW 8 114488952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTGGCAGTAAAAGCTG -3'
(R):5'- CCTTAACCGTACATATAAATGAGCCTC -3'

Sequencing Primer
(F):5'- GCAGTAAAAGCTGTGTTCTTCC -3'
(R):5'- ATAAATGAGCCTCTGGTGCC -3'
Posted On2019-05-13