Incidental Mutation 'R7043:Zfp365'
ID547167
Institutional Source Beutler Lab
Gene Symbol Zfp365
Ensembl Gene ENSMUSG00000037855
Gene Namezinc finger protein 365
SynonymsSu48, DBZ
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location67886103-67912662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67909826 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000067197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064656]
Predicted Effect probably damaging
Transcript: ENSMUST00000064656
AA Change: S41P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067197
Gene: ENSMUSG00000037855
AA Change: S41P

DomainStartEndE-ValueType
ZnF_C2H2 26 51 4.05e-1 SMART
coiled coil region 170 298 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal cortical basket cells in the somatosensory cortices, delayed myelination in the corpus callosum during the early postnatal period, and an increase in immature oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Other mutations in Zfp365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp365 APN 10 67909354 missense probably damaging 1.00
IGL03257:Zfp365 APN 10 67889038 missense possibly damaging 0.76
ANU18:Zfp365 UTSW 10 67909354 missense probably damaging 1.00
R0482:Zfp365 UTSW 10 67897606 missense probably damaging 1.00
R1800:Zfp365 UTSW 10 67888942 missense probably damaging 0.98
R1986:Zfp365 UTSW 10 67909856 missense probably damaging 1.00
R4279:Zfp365 UTSW 10 67897601 missense probably benign 0.44
R4475:Zfp365 UTSW 10 67888920 missense possibly damaging 0.87
R4951:Zfp365 UTSW 10 67889991 critical splice acceptor site probably null
R5599:Zfp365 UTSW 10 67909367 missense probably damaging 1.00
R5682:Zfp365 UTSW 10 67909807 missense probably damaging 1.00
R5697:Zfp365 UTSW 10 67909640 missense probably benign 0.01
R5837:Zfp365 UTSW 10 67889040 missense probably damaging 1.00
R5982:Zfp365 UTSW 10 67897607 missense probably damaging 1.00
R6974:Zfp365 UTSW 10 67909764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAAGGGTTTCGTGTCCTTG -3'
(R):5'- TGACAGACCTGTAAACTGGGG -3'

Sequencing Primer
(F):5'- GCTGTACAAGTTAACATAGCTCGAC -3'
(R):5'- ACAGACCTGTAAACTGGGGTCTTC -3'
Posted On2019-05-13