Incidental Mutation 'R7043:Avpr1a'
ID547169
Institutional Source Beutler Lab
Gene Symbol Avpr1a
Ensembl Gene ENSMUSG00000020123
Gene Namearginine vasopressin receptor 1A
SynonymsV1aR
Accession Numbers

Genbank: NM_016847; MGI: 1859216

Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location122448499-122453452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122449681 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 293 (R293C)
Ref Sequence ENSEMBL: ENSMUSP00000020323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020323]
Predicted Effect probably damaging
Transcript: ENSMUST00000020323
AA Change: R293C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020323
Gene: ENSMUSG00000020123
AA Change: R293C

DomainStartEndE-ValueType
Pfam:7tm_4 58 206 8.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 62 362 6.1e-10 PFAM
Pfam:7tm_1 68 353 4.5e-49 PFAM
Pfam:7TM_GPCR_Srv 98 370 1.5e-10 PFAM
DUF1856 377 423 2e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a receptor for arginine vasopressin, a neurohypophyseal hormone involved in diuresis inhibition, smooth muscle contraction, liver glycogenolysis stimulation and regulation of adrenocorticotropic hormone release from the pituitary. This receptor represents one of three G protein-coupled arginine vasopressin receptors which functions through a phosphotidylinositol-calcium second messenger system in vascular and hepatic tissues [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a stimulus processing deficit similar to that seen in schizophrenia. Anxiety-like behaviors are reduced in males but not females. B cell development is also affected. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Avpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Avpr1a APN 10 122449351 missense probably benign
IGL01062:Avpr1a APN 10 122449529 missense probably damaging 0.99
IGL01317:Avpr1a APN 10 122449567 missense probably benign
IGL01813:Avpr1a APN 10 122449011 missense probably damaging 1.00
IGL01947:Avpr1a APN 10 122452182 missense probably benign 0.00
IGL02549:Avpr1a APN 10 122452164 missense possibly damaging 0.91
IGL02967:Avpr1a APN 10 122449462 missense possibly damaging 0.95
IGL03114:Avpr1a APN 10 122449718 missense probably damaging 0.99
H8786:Avpr1a UTSW 10 122449468 missense probably benign 0.01
R0211:Avpr1a UTSW 10 122449469 missense possibly damaging 0.54
R0268:Avpr1a UTSW 10 122449709 missense probably damaging 1.00
R1188:Avpr1a UTSW 10 122448919 missense possibly damaging 0.85
R1909:Avpr1a UTSW 10 122452208 missense probably benign
R1935:Avpr1a UTSW 10 122449790 critical splice donor site probably null
R2404:Avpr1a UTSW 10 122449210 missense possibly damaging 0.78
R3707:Avpr1a UTSW 10 122449109 missense probably damaging 1.00
R3927:Avpr1a UTSW 10 122449711 missense probably benign 0.00
R4722:Avpr1a UTSW 10 122449001 missense possibly damaging 0.62
R4952:Avpr1a UTSW 10 122449754 missense probably damaging 0.98
R5384:Avpr1a UTSW 10 122449369 missense probably damaging 1.00
R5807:Avpr1a UTSW 10 122449471 missense probably benign 0.14
R6024:Avpr1a UTSW 10 122449148 missense probably damaging 0.99
Z1088:Avpr1a UTSW 10 122449577 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTACCCGTGATCATCTTGG -3'
(R):5'- AGGTCCCAGGAATTTGCAATTTTG -3'

Sequencing Primer
(F):5'- GGTACCTGCTATGGCTTCATCTG -3'
(R):5'- ATAACATACATACACACACACACC -3'
Posted On2019-05-13