Incidental Mutation 'R7043:Ndel1'
ID547171
Institutional Source Beutler Lab
Gene Symbol Ndel1
Ensembl Gene ENSMUSG00000018736
Gene NamenudE neurodevelopment protein 1 like 1
Synonyms2600006O07Rik, mNudel
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68821434-68871858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68822624 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 329 (L329P)
Ref Sequence ENSEMBL: ENSMUSP00000018880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018880
AA Change: L329P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018880
Gene: ENSMUSG00000018736
AA Change: L329P

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 309 6.6e-49 PFAM
low complexity region 322 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this gene causes peri-implantation lethality. Blastocysts fail to grow in culture and exhibit inner cell mass degeneration. Compound heterozygous mice carrying one null and one hypomorphic allele show mild neuronal migration defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Ndel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03236:Ndel1 APN 11 68842150 missense probably benign 0.05
FR4342:Ndel1 UTSW 11 68833409 missense probably damaging 0.97
R0025:Ndel1 UTSW 11 68836173 missense probably damaging 0.97
R0088:Ndel1 UTSW 11 68833420 missense probably damaging 0.98
R1510:Ndel1 UTSW 11 68822656 missense possibly damaging 0.80
R1944:Ndel1 UTSW 11 68829920 missense probably benign
R4710:Ndel1 UTSW 11 68845337 missense probably damaging 0.99
R5940:Ndel1 UTSW 11 68822571 utr 3 prime probably benign
R6293:Ndel1 UTSW 11 68836275 missense probably damaging 1.00
R6678:Ndel1 UTSW 11 68833413 missense possibly damaging 0.87
R7107:Ndel1 UTSW 11 68822648 missense possibly damaging 0.90
X0013:Ndel1 UTSW 11 68839988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATATCGCGCAGAGTCCTG -3'
(R):5'- TAGCTGTGATCCTACTGTGGGTAAG -3'

Sequencing Primer
(F):5'- ATGCAGCCTGCCCTCTG -3'
(R):5'- TCCTACTGTGGGTAAGGAAGAG -3'
Posted On2019-05-13