Incidental Mutation 'R7043:Tk1'
ID547174
Institutional Source Beutler Lab
Gene Symbol Tk1
Ensembl Gene ENSMUSG00000025574
Gene Namethymidine kinase 1
SynonymsD530002A18Rik, Tk-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117815526-117826092 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 117815953 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 234 (*234R)
Ref Sequence ENSEMBL: ENSMUSP00000026661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026649] [ENSMUST00000026661] [ENSMUST00000120928] [ENSMUST00000132298] [ENSMUST00000143852] [ENSMUST00000177131] [ENSMUST00000177241]
Predicted Effect probably benign
Transcript: ENSMUST00000026649
SMART Domains Protein: ENSMUSP00000026649
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 165 1.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026661
AA Change: *234R
SMART Domains Protein: ENSMUSP00000026661
Gene: ENSMUSG00000025574
AA Change: *234R

DomainStartEndE-ValueType
Pfam:TK 19 189 9.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120928
SMART Domains Protein: ENSMUSP00000113941
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 21 135 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143852
SMART Domains Protein: ENSMUSP00000135529
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
Pfam:MARVEL 14 118 8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175737
SMART Domains Protein: ENSMUSP00000134879
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:MARVEL 18 121 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177131
SMART Domains Protein: ENSMUSP00000134789
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 162 3.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177241
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic enzyme that catalyzes the addition of a gamma-phosphate group to thymidine. This creates dTMP and is the first step in the biosynthesis of dTTP, which is one component required for DNA replication. The encoded protein, whose levels fluctuate depending on the cell cycle stage, can act as a low activity dimer or a high activity tetramer. High levels of this protein have been used as a biomarker for diagnosing and categorizing many types of cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Nullizygous mice show partial postnatal lethality, poor fertility, hemosiderosis, lymphocyte and spleen anomalies, altered sublingual gland secretion, inflammation of the arteries, lung, liver and thyroid, abnormal spermatogenesis and glomerulosclerosis leading to kidney failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Tk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02082:Tk1 APN 11 117825727 unclassified probably null
IGL02088:Tk1 APN 11 117824665 unclassified probably benign
tica UTSW 11 117817122 unclassified probably benign
tico UTSW 11 117816541 missense probably damaging 1.00
tock UTSW 11 117816494 missense probably damaging 1.00
R0310:Tk1 UTSW 11 117817095 unclassified probably benign
R0811:Tk1 UTSW 11 117822107 missense probably damaging 1.00
R0812:Tk1 UTSW 11 117822107 missense probably damaging 1.00
R1180:Tk1 UTSW 11 117822095 critical splice donor site probably null
R5160:Tk1 UTSW 11 117824746 missense possibly damaging 0.78
R5287:Tk1 UTSW 11 117816541 missense probably damaging 1.00
R5846:Tk1 UTSW 11 117815922 unclassified probably benign
R5886:Tk1 UTSW 11 117817122 unclassified probably benign
R6862:Tk1 UTSW 11 117816494 missense probably damaging 1.00
R7292:Tk1 UTSW 11 117825777 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- CACCAGTGTCACAATGCTGGAC -3'
(R):5'- CCGACAAGTATCACTCCGTG -3'

Sequencing Primer
(F):5'- TCACCTTTGGCTGAACACGG -3'
(R):5'- ACAAGTATCACTCCGTGTGCCG -3'
Posted On2019-05-13