Incidental Mutation 'R7043:Serpinb9f'
ID547177
Institutional Source Beutler Lab
Gene Symbol Serpinb9f
Ensembl Gene ENSMUSG00000038327
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9f
SynonymsNK21, ovalbumin, Spi13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33324077-33335370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33325987 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 54 (I54T)
Ref Sequence ENSEMBL: ENSMUSP00000074958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075515]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075515
AA Change: I54T

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074958
Gene: ENSMUSG00000038327
AA Change: I54T

DomainStartEndE-ValueType
SERPIN 13 377 2.03e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Serpinb9f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Serpinb9f APN 13 33334468 missense probably damaging 1.00
IGL03272:Serpinb9f APN 13 33327916 missense probably damaging 1.00
R0112:Serpinb9f UTSW 13 33327951 splice site probably benign
R0254:Serpinb9f UTSW 13 33334591 missense probably damaging 1.00
R0498:Serpinb9f UTSW 13 33326007 splice site probably benign
R0711:Serpinb9f UTSW 13 33327921 missense probably damaging 1.00
R1004:Serpinb9f UTSW 13 33334242 critical splice acceptor site probably benign
R1913:Serpinb9f UTSW 13 33325846 missense probably damaging 1.00
R2214:Serpinb9f UTSW 13 33334609 missense probably benign 0.00
R3908:Serpinb9f UTSW 13 33327936 missense probably damaging 0.99
R6182:Serpinb9f UTSW 13 33334422 missense probably damaging 1.00
R6421:Serpinb9f UTSW 13 33334533 missense probably benign 0.01
R6965:Serpinb9f UTSW 13 33325876 missense possibly damaging 0.50
X0019:Serpinb9f UTSW 13 33334534 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACACTGCATCATGAATACTCTGTC -3'
(R):5'- TCCCAGGCTCCATCAAATAGTATG -3'

Sequencing Primer
(F):5'- GAATACTCTGTCTCAAGCCAATGG -3'
(R):5'- CAAGTAGCCTAGGGATTTTCCAGC -3'
Posted On2019-05-13