Incidental Mutation 'R7043:Zc3h3'
ID547180
Institutional Source Beutler Lab
Gene Symbol Zc3h3
Ensembl Gene ENSMUSG00000075600
Gene Namezinc finger CCCH type containing 3
SynonymsSmicl
MMRRC Submission
Accession Numbers

Genbank: NM_172121.1; Ensembl: ENSMUST00000100538

Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location75754430-75841915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75809636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 532 (I532T)
Ref Sequence ENSEMBL: ENSMUSP00000098106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100538]
Predicted Effect probably damaging
Transcript: ENSMUST00000100538
AA Change: I532T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098106
Gene: ENSMUSG00000075600
AA Change: I532T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 370 388 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
ZnF_C3H1 663 689 1.03e-2 SMART
ZnF_C3H1 690 716 1.16e-1 SMART
ZnF_C3H1 718 743 5.38e-6 SMART
ZnF_C3H1 745 771 2.88e-6 SMART
ZnF_C3H1 772 794 1.64e-1 SMART
low complexity region 839 888 N/A INTRINSIC
low complexity region 895 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Zc3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Zc3h3 APN 15 75779313 missense probably damaging 1.00
1mM(1):Zc3h3 UTSW 15 75840565 critical splice acceptor site probably null
R0477:Zc3h3 UTSW 15 75777083 missense possibly damaging 0.93
R0843:Zc3h3 UTSW 15 75837479 missense probably benign 0.00
R1891:Zc3h3 UTSW 15 75756931 missense possibly damaging 0.47
R1918:Zc3h3 UTSW 15 75777118 missense probably damaging 1.00
R2009:Zc3h3 UTSW 15 75779309 missense probably damaging 1.00
R2257:Zc3h3 UTSW 15 75839566 missense possibly damaging 0.77
R3853:Zc3h3 UTSW 15 75837497 missense probably benign 0.03
R5130:Zc3h3 UTSW 15 75779290 missense probably damaging 1.00
R5160:Zc3h3 UTSW 15 75809663 missense probably benign 0.02
R5164:Zc3h3 UTSW 15 75777026 missense probably benign 0.02
R5279:Zc3h3 UTSW 15 75839590 missense probably benign 0.08
R5622:Zc3h3 UTSW 15 75777079 missense probably damaging 1.00
R5743:Zc3h3 UTSW 15 75779531 nonsense probably null
R5923:Zc3h3 UTSW 15 75785564 missense probably damaging 0.99
R6294:Zc3h3 UTSW 15 75809568 missense possibly damaging 0.90
R6377:Zc3h3 UTSW 15 75839455 missense probably damaging 0.99
R6735:Zc3h3 UTSW 15 75756634 missense probably benign 0.00
R7231:Zc3h3 UTSW 15 75840382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCTAAGATCCTATAGCC -3'
(R):5'- AGGCTAAGGGGACATCTGTG -3'

Sequencing Primer
(F):5'- AAGGCCTCAATCTTCAGTCC -3'
(R):5'- CTAAGGGGACATCTGTGTGTGTAAG -3'
Posted On2019-05-13