Incidental Mutation 'R7043:H2-T23'
ID547187
Institutional Source Beutler Lab
Gene Symbol H2-T23
Ensembl Gene ENSMUSG00000067212
Gene Namehistocompatibility 2, T region locus 23
Synonyms37b, T18c(37), 37c, Qa-1, Qed-1, T23b, T18c, T23d, H-2T23, Qa1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36029773-36032855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36031911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 112 (S112T)
Ref Sequence ENSEMBL: ENSMUSP00000099739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102678]
PDB Structure
Structure of the MHC class Ib molecule Qa-1b [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102678
AA Change: S112T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099739
Gene: ENSMUSG00000067212
AA Change: S112T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 21 199 1.9e-93 PFAM
IGc1 218 289 1.89e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: CD4+ T cells from mice with a homozygous null mutation have enhanced responses after infection or immunization, are resistant to suppressor activity mediated by a subset of CD8+ T cells, but are more susceptible to NK cell lysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in H2-T23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:H2-T23 APN 17 36031781 missense probably damaging 1.00
IGL01685:H2-T23 APN 17 36032644 missense probably benign 0.29
IGL02756:H2-T23 APN 17 36031688 missense probably damaging 1.00
IGL03036:H2-T23 APN 17 36032357 missense possibly damaging 0.73
LCD18:H2-T23 UTSW 17 36031216 intron probably benign
R0539:H2-T23 UTSW 17 36032141 splice site probably benign
R0845:H2-T23 UTSW 17 36030583 missense probably benign 0.00
R1727:H2-T23 UTSW 17 36031653 missense possibly damaging 0.52
R2044:H2-T23 UTSW 17 36032191 missense probably damaging 1.00
R3121:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3122:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3943:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R3944:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R4492:H2-T23 UTSW 17 36032166 missense probably damaging 0.97
R4660:H2-T23 UTSW 17 36030216 missense probably damaging 0.99
R4669:H2-T23 UTSW 17 36031798 missense probably damaging 1.00
R4740:H2-T23 UTSW 17 36032124 intron probably benign
R5151:H2-T23 UTSW 17 36032338 missense probably damaging 1.00
R5196:H2-T23 UTSW 17 36032607 critical splice donor site probably null
R5237:H2-T23 UTSW 17 36030366 splice site probably null
R5307:H2-T23 UTSW 17 36032216 missense probably benign 0.00
R5336:H2-T23 UTSW 17 36031658 missense possibly damaging 0.85
R5646:H2-T23 UTSW 17 36031803 missense possibly damaging 0.49
R5800:H2-T23 UTSW 17 36031604 intron probably benign
R6013:H2-T23 UTSW 17 36030582 missense probably benign 0.00
R6081:H2-T23 UTSW 17 36031815 missense possibly damaging 0.90
R6382:H2-T23 UTSW 17 36031832 missense probably damaging 1.00
R7134:H2-T23 UTSW 17 36031817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGACTGCCTCTGACTTGTG -3'
(R):5'- CAGCTATGATCACTCCATGTCC -3'

Sequencing Primer
(F):5'- GCCTCTGACTTGTGCTTAGAGATC -3'
(R):5'- GTCATCTTGACCCGCTGAGAC -3'
Posted On2019-05-13