Incidental Mutation 'R7043:Kmt5b'
ID547188
Institutional Source Beutler Lab
Gene Symbol Kmt5b
Ensembl Gene ENSMUSG00000045098
Gene Namelysine methyltransferase 5B
SynonymsC630029K18Rik, Suv420h1, Suv4-20h1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3767421-3818303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3815220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 738 (S738R)
Ref Sequence ENSEMBL: ENSMUSP00000135563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113972] [ENSMUST00000113973] [ENSMUST00000113974] [ENSMUST00000113977] [ENSMUST00000176262]
Predicted Effect probably benign
Transcript: ENSMUST00000113972
AA Change: S761R

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109605
Gene: ENSMUSG00000045098
AA Change: S761R

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113973
AA Change: S761R

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109606
Gene: ENSMUSG00000045098
AA Change: S761R

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113974
AA Change: S738R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109607
Gene: ENSMUSG00000045098
AA Change: S738R

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113977
AA Change: S738R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109610
Gene: ENSMUSG00000045098
AA Change: S738R

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176262
AA Change: S738R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135563
Gene: ENSMUSG00000045098
AA Change: S738R

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are born at sub-Mendelian ratios, are smaller than control littermates, and die within a few hours of birth, probably due to alveolar defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Kmt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Kmt5b APN 19 3786618 missense possibly damaging 0.86
IGL02005:Kmt5b APN 19 3786538 missense possibly damaging 0.50
IGL02058:Kmt5b APN 19 3793181 missense probably damaging 1.00
IGL02069:Kmt5b APN 19 3807335 missense probably damaging 1.00
IGL02395:Kmt5b APN 19 3814887 missense probably benign 0.01
IGL02701:Kmt5b APN 19 3796681 missense probably benign 0.08
P0047:Kmt5b UTSW 19 3793223 splice site probably benign
R0127:Kmt5b UTSW 19 3786465 start codon destroyed probably null 0.99
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1797:Kmt5b UTSW 19 3814833 missense probably benign 0.03
R2178:Kmt5b UTSW 19 3815372 missense possibly damaging 0.68
R2418:Kmt5b UTSW 19 3807266 missense probably benign 0.00
R4290:Kmt5b UTSW 19 3802193 missense possibly damaging 0.51
R4789:Kmt5b UTSW 19 3815330 missense probably benign 0.00
R4939:Kmt5b UTSW 19 3815245 missense possibly damaging 0.88
R5133:Kmt5b UTSW 19 3802240 missense probably damaging 1.00
R5392:Kmt5b UTSW 19 3802127 missense possibly damaging 0.84
R5568:Kmt5b UTSW 19 3786538 missense probably benign 0.00
R6029:Kmt5b UTSW 19 3802104 missense probably damaging 0.99
R6184:Kmt5b UTSW 19 3804499 missense probably damaging 1.00
R6649:Kmt5b UTSW 19 3807295 missense probably damaging 0.96
R7131:Kmt5b UTSW 19 3815412 missense probably benign 0.00
R7203:Kmt5b UTSW 19 3814147 missense probably damaging 1.00
R7287:Kmt5b UTSW 19 3804501 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGATCCTGGAGAACAGCTCTGG -3'
(R):5'- CATCGAAGTCATCCTCGCAG -3'

Sequencing Primer
(F):5'- CTGGAGAACAGCTCTGGAATCC -3'
(R):5'- AGGATTCATCTGTGCTGTCC -3'
Posted On2019-05-13