Incidental Mutation 'R7044:Olfr1186'
ID547196
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7044 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88526486 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 301 (N301S)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000121619
AA Change: N301S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215912
AA Change: N301S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216978
AA Change: N301S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGAAGCCACAGTGCAG -3'
(R):5'- CAGTAAGCTATGTCACAGGTCCTAG -3'

Sequencing Primer
(F):5'- GACGAAAGGCCTTGTCTACATGC -3'
(R):5'- GCTATGTCACAGGTCCTAGATTATTG -3'
Posted On2019-05-13