Incidental Mutation 'R7044:Poteg'
ID547213
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7044 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27449895 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 27 (C27R)
Ref Sequence ENSEMBL: ENSMUSP00000147714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect probably damaging
Transcript: ENSMUST00000081321
AA Change: C89R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: C89R

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209669
AA Change: C27R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210427
AA Change: C85R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCTAGCAGGAAGGAG -3'
(R):5'- GGAGGCAAAGTTCTTTCCATTG -3'

Sequencing Primer
(F):5'- TCCCTAGCAGGAAGGAGATCTATAC -3'
(R):5'- GGCAAAGTTCTTTCCATTGTAAGCG -3'
Posted On2019-05-13