Incidental Mutation 'R7044:Glyat'
ID547231
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12650265 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000114002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect probably benign
Transcript: ENSMUST00000044976
AA Change: S109P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: S109P

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119960
AA Change: S75P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683
AA Change: S75P

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2416:Glyat UTSW 19 12651254 missense possibly damaging 0.50
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R2960:Glyat UTSW 19 12639850 missense probably damaging 1.00
R3958:Glyat UTSW 19 12639833 missense probably benign 0.05
R4126:Glyat UTSW 19 12651479 missense probably benign 0.03
R4561:Glyat UTSW 19 12651280 missense possibly damaging 0.88
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTGTCTGCTCACAAAATGAC -3'
(R):5'- CAAACTCACATGGCCTTGGG -3'

Sequencing Primer
(F):5'- TAAGATAGGGGGTATTATGTCAGCC -3'
(R):5'- GGGCTTGCCACTTCCTG -3'
Posted On2019-05-13